IthaID: 2927


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs13419896 HGVS Name: NG_016000.1:g.36805G>A

Context nucleotide sequence:
GTAGGCCAGTGTCTGAAAGTGAAGC [A/G] CTAGGATTGGTTACTGACTCTGGTT (Strand: +)

Also known as:

Comments: SNP associated with haemoglobin levels in Tibetans living at high altitudes (n=91).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 2
Locus: NG_016000.1
Locus Location: 36805
Size: 1 bp
Located at: EPAS1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Tibetan
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Beall CM, Cavalleri GL, Deng L, Elston RC, Gao Y, Knight J, Li C, Li JC, Liang Y, McCormack M, Montgomery HE, Pan H, Robbins PA, Shianna KV, Tam SC, Tsering N, Veeramah KR, Wang W, Wangdui P, Weale ME, Xu Y, Xu Z, Yang L, Zaman MJ, Zeng C, Zhang L, Zhang X, Zhaxi P, Zheng YT, Natural selection on EPAS1 (HIF2alpha) associated with low hemoglobin concentration in Tibetan highlanders., Proc. Natl. Acad. Sci. U.S.A. , 107(25), 11459-64, 2010
Created on 2016-06-07 09:32:21, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.