
IthaID: 2939
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2794452 | HGVS Name: | NC_000001.11:g.203468576T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATACATGTGCGTTTTCCAGGCTGTC [A/G] TCAAGAATGATTCTGATCTGTGCCC (Strand: -)
Comments: SNP associated with elevated tricuspid regurgitant jet velocity (TRV) in African Americans with sickle cell disease (49 cases; 63 controls). Elevated TRV has a positive predictive value for pulmonary hypertension.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Desai AA, Zhou T, Ahmad H, Zhang W, Mu W, Trevino S, Wade MS, Raghavachari N, Kato GJ, Peters-Lawrence MH, Thiruvoipati T, Turner K, Artz N, Huang Y, Patel AR, Yuan JX, Gordeuk VR, Lang RM, Garcia JG, Machado RF, A novel molecular signature for elevated tricuspid regurgitation velocity in sickle cell disease., Am. J. Respir. Crit. Care Med. , 186(4), 359-68, 2012
- Wonkam A, Makani J, Ofori-Aquah S, Nnodu OE, Treadwell M, Royal C, Ohene-Frempong K, , Sickle cell disease and H3Africa: enhancing genomic research on cardiovascular diseases in African patients., Cardiovasc J Afr , 26(2), S50-5, 2015
Created on 2016-08-09 11:00:50,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.