
IthaID: 2949
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs8099917 | HGVS Name: | NC_000019.10:g.39252525T>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTTGTTTTCCTTTCTGTGAGCAAT [G/T] TCACCCAAATTGGAACCATGCTGTA (Strand: +)
Comments: SNP is located 8 kb upstream of the IFNL3 gene. The T allele has been associated with a sustained virological response to antiviral therapy in thalassaemic patients with Hepatitis C from Iran and India.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Response to Hepatitis C treatment |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_042193.1 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | IFNL3 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Iranian, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Behnava B, Sharafi H, Keshvari M, Pouryasin A, Mehrnoush L, Salimi S, Karimi Elizee P, Ghazimoghaddam M, Alavian SM, The Role of Polymorphisms Near the IL28B Gene on Response to Peg-Interferon and Ribavirin in Thalassemic Patients With Hepatitis C., Hepat Mon , 16(1), e32703, 2016
- Biswas A, Firdaus R, Gupta D, Ghosh M, Saha K, Chowdhury P, Bhattacharyya M, Sadhukhan PC, Interferon λ3 gene (IL28B) is associated with spontaneous or treatment-induced viral clearance in hepatitis C virus-infected multitransfused patients with thalassemia., Transfusion , 57(6), 1376-1384, 2017
Created on 2016-08-09 15:36:05,
Last reviewed on 2019-07-03 14:47:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.