IthaID: 2949
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs8099917 | HGVS Name: | NC_000019.10:g.39252525T>G |
Context nucleotide sequence:
TTTTGTTTTCCTTTCTGTGAGCAAT [G/T] TCACCCAAATTGGAACCATGCTGTA (Strand: +)
Also known as:
Comments: SNP is located 8 kb upstream of the IFNL3 gene. The T allele has been associated with a sustained virological response to antiviral therapy in thalassaemic patients with Hepatitis C from Iran and India.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Response to Hepatitis C treatment |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_042193.1 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | IFNL3 |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Iranian, Indian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Behnava B, Sharafi H, Keshvari M, Pouryasin A, Mehrnoush L, Salimi S, Karimi Elizee P, Ghazimoghaddam M, Alavian SM, The Role of Polymorphisms Near the IL28B Gene on Response to Peg-Interferon and Ribavirin in Thalassemic Patients With Hepatitis C., Hepat Mon , 16(1), e32703, 2016
- Biswas A, Firdaus R, Gupta D, Ghosh M, Saha K, Chowdhury P, Bhattacharyya M, Sadhukhan PC, Interferon λ3 gene (IL28B) is associated with spontaneous or treatment-induced viral clearance in hepatitis C virus-infected multitransfused patients with thalassemia., Transfusion , 57(6), 1376-1384, 2017
Created on 2016-08-09 15:36:05,
Last reviewed on 2019-07-03 14:47:06 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-08-09 15:36:05 | The IthaGenes Curation Team | Created |
2 | 2016-08-09 15:39:23 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-08-09 15:41:01 | The IthaGenes Curation Team | Reviewed. |
4 | 2017-07-03 11:16:25 | The IthaGenes Curation Team | Reviewed. Mutation Comment and Other Details sections updated. Reference added. |
5 | 2019-07-03 14:47:06 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-29 12:50:12