IthaID: 3033

Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: IVS I-27 C>T HGVS Name: HBA2:c.95+27C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGAGGCTCCCTCCCCTGCTCCGACC [C>T] GGGCTCCTCGCCCGCCCGGACCCAC (Strand: +)

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33897
Size: 1 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2016-08-26 13:18:15, Last reviewed on 2021-03-11 15:38:18 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.