
IthaID: 3097
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1867504 | HGVS Name: | NG_008673.3:g.196A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTTAAGCCCATCGTGGTAGAAATCT [A/G] TGGGTCAAAAGATGGTGTGTTCTCC (Strand: +)
Comments: SNP (allele A) associated with increased haemoglobin and serum ferritin concentrations in African ancestry populations.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Increased serum ferritin [HP:0003281] Anaemia [HP:0001903] |
Location
| Chromosome: | 3 |
|---|---|
| Locus: | NG_013080.1 |
| Locus Location: | 196 |
| Size: | 1 bp |
| Located at: | TF |
| Specific Location: | Intron |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Kenyan, Tanzanian, South African, African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gichohi-Wainaina WN, Tanaka T, Towers GW, Verhoef H, Veenemans J, Talsma EF, Harryvan J, Boekschoten MV, Feskens EJ, Melse-Boonstra A, Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry., PLoS ONE , 11(6), e0157996, 2016
Created on 2016-09-14 18:08:51,
Last reviewed on 2019-07-03 23:29:25 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.