
IthaID: 3116
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1799963 | HGVS Name: | NG_008953.1:g.25313G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTTCCCAATAAAAGTGACTCTCAGY [A/G] AGCCTCAATGCTCCCAGTGCTATTC (Strand: +)
Comments: This SNP was described in a splenectomized patient with HbH disease and recurrent thromboembolism. It presents a significant risk factor for venous thrombosis.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Thromboembolism [HP:0001907] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_008953.1 |
| Locus Location: | 25313 |
| Size: | 1 bp |
| Located at: | F2 |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese Han |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Sun NA, Cheng P, Deng DH, Liu RR, Lai YR, Analysis of the genetic variants associated with recurrent thromboembolism in a patient with hemoglobin H disease following splenectomy: A case report., Biomed Rep , 5(1), 23-26, 2016
Created on 2016-09-29 18:21:31,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.