IthaID: 3140
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 114 CCC>CC- | HGVS Name: | HBA2:c.345delC |
Hb Name: | N/A | Protein Info: | α2 114(-C); modified C-terminal sequence: (114)Pro-Pro-Ser-Ser-Pro-Leu-Arg-Cys-Thr-Pro- Pro-Trp-Thr-Ser-Ser-Trp-Leu-Leu-(132)COOH |
Context nucleotide sequence:
GTGACCCTGGCCGCCCACCTCCC [C/-] GCCGAGTTCACCCCTGCGGTGCA (Strand: +)
Also known as:
Comments: The deletion creates a frame shift starting at codon Ala115. The new reading frame ends in stop codon 17 positions downstream.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34379 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Norwegian, African American |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Eng B, Patterson M, Walker L, Hoppe C, Azimi M, Lee H, Giordano PC, Waye JS, Three new alpha-thalassemia point mutations ascertained through newborn screening., Hemoglobin, 30(2), 149-53, 2006
- Grimholt RM, Fjeld B, Klingenberg O, Hemoglobinopathy gone astray-three novel forms of α-thalassemia in Norwegian patients characterized by quantitative real-time PCR and DNA sequencing., Scand J Clin Lab Invest, 2021
Created on 2017-01-17 10:53:53,
Last reviewed on 2021-11-22 11:22:36 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2017-01-17 10:53:53 | The IthaGenes Curation Team | Created |
2 | 2021-10-21 14:32:38 | The IthaGenes Curation Team | Reviewed. Reference and origin added. |
3 | 2021-11-22 11:21:00 | The IthaGenes Curation Team | Reviewed. Reference and link added. |
4 | 2021-11-22 11:22:36 | The IthaGenes Curation Team | Reviewed. Allele phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36