
IthaID: 3145
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1984112 | HGVS Name: | NG_008192.1:g.16417A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTACTGAACAGGAAACTGTAGTTA [A/G] GAAGTAAAAATCACAGTGAAAAATT (Strand: +)
Comments: SNP (G allele) associated with a higher level of reticulocyte count in Portuguese (Sub-Saharan African ancestry) and Tunisian children with sickle cell disease (SCD). It showed weak association with vaso-occlusive crisis in the Tunisian SCD cohort.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Vaso-occlusive crisis Reticulocytosis [HP:0001923] |
Location
| Chromosome: | 7 |
|---|---|
| Locus: | NG_008192.1 |
| Locus Location: | 16417 |
| Size: | 1 bp |
| Located at: | CD36 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Tunisian, Sub-Saharan African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Coelho A, Dias A, Morais A, Nunes B, Ferreira E, Picanço I, Faustino P, Lavinha J, Genetic variation in CD36, HBA, NOS3 and VCAM1 is associated with chronic haemolysis level in sickle cell anaemia: a longitudinal study., Eur. J. Haematol. , 92(3), 237-43, 2014
- Kalai M, Dridi M, Chaouch L, Moumni I, Ouragini H, Darragi I, Boudrigua I, Chaouachi D, Mellouli F, Bejaoui M, Abbes S, The role of rs1984112_G at CD36 gene in increasing reticulocyte level among sickle cell disease patients., Hematology , 2016
Created on 2017-01-23 11:29:08,
Last reviewed on 2019-07-03 15:55:00 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.