IthaID: 3146

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1800587 HGVS Name: NG_008850.1:g.5012C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTTTAATAATAGTAACCAGGCAACA [C/T] CATTGAAGGCTCATATGTAAAAATC (Strand: -)

Comments: SNP (T allele) associated with chronic pain in African-Americans with sickle cell disease.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Location

Chromosome: 2
Locus: NG_008850.1
Locus Location: 5012
Size: 1 bp
Located at: ILA1
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Hu X, Jhun EH, Yao Y, He Y, Molokie RE, Wilkie DJ, Wang ZJ, IL1A rs1800587 associates with chronic noncrisis pain in sickle cell disease., Pharmacogenomics , 17(18), 1999-2006, 2016
  2. Hu X, Jhun E, Yao Y, He Y, Molokie R, Wilkie D, Wang Z, (280) Interleukin 1alpha rs1800587 associates with chronic non-crisis pain in sickle cell disease., J Pain , 17(4), S46, 2016
Created on 2017-01-23 15:40:30, Last reviewed on 2017-02-28 12:12:34 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.