
IthaID: 3178
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2010963 | HGVS Name: | NG_008732.1:g.5398C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CGCGCGGGCGTGCGAGCAGCGAAAG [C/G] GACAGGGGCAAAGTGAGTGACCTGC (Strand: +)
Comments: SNP associated with vaso-occlusive crisis in Bahraini with sickle cell anaemia.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Vaso-occlusive crisis |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NG_008732.1 |
| Locus Location: | 5398 |
| Size: | 1 bp |
| Located at: | VEGFA |
| Specific Location: | 5'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Bahraini |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Al-Habboubi HH, Mahdi N, Abu-Hijleh TM, Abu-Hijleh FM, Sater MS, Almawi WY, The relation of vascular endothelial growth factor (VEGF) gene polymorphisms on VEGF levels and the risk of vasoocclusive crisis in sickle cell disease., Eur. J. Haematol. , 89(5), 403-9, 2012
Created on 2017-02-14 14:42:00,
Last reviewed on 2017-02-14 14:43:27 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.