
IthaID: 3197
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs10877969 | HGVS Name: | NC_000012.12:g.63153459T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTGTAGAACCAGTCCCTTTGTTTAA [T/C] CCATATAGTTTTAAACATGTTTTTG (Strand: +)
Comments: SNV associated with acute pain in African Americans with sickle cell disease (n=107). The CT genotype associated with more frequent acute SCD pain utilization events. Individuals with the CC genotype were less likely to report stress as a pain aggravator.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pain [HP:0012531] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Roach K, Jhun E, He Y, Suarez M, Yao Y, Molokie R, Wang Z, Wilkie D, (245) Vasopressin SNP is related to sickle cell acute care utilization for pain., J Pain , 17(4), S36, 2016
- Powell-Roach KL, Yao Y, Jhun EH, He Y, Suarez ML, Ezenwa MO, Molokie RE, Wang ZJ, Wilkie DJ, Vasopressin SNP pain factors and stress in sickle cell disease., PLoS ONE, 14(11), e0224886, 2019
Created on 2017-02-28 12:02:34,
Last reviewed on 2020-05-19 10:46:46 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.