
IthaID: 3207
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs76056952 | HGVS Name: | NG_033236.1:g.77856G>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGGAGCTGACGATTCTTGACACATC [C/G] TGGTGGGGAAAGGGGCCATAAGCCA (Strand: +)
Comments: SNP associated with protection against elevated glomerular filtration rate in SCA pediatric patients enrolled from the HUSTLE (Hydroxyurea Study of Long-term Effects) and TWiTCH (TCD With Transfusions Changing to Hydroxyurea) clinical trials.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Abnormal GFR [HP:0012212] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_033236.1 |
| Locus Location: | 77856 |
| Size: | 1 bp |
| Located at: | PKD1L2 |
| Specific Location: | Intron 29 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Consensus splice site (mRNA Processing) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016
Created on 2017-03-20 16:27:46,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.