IthaID: 3254
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs5742909 | HGVS Name: | NG_011502.1:g.4839C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTCTCCACTTAGTTATCCAGATCCT [C/T] AAAGTGAACATGAAGCTTCAGTTTC (Strand: +)
Comments: SNP (T allele) associated with a higher risk of post-transfusion alloantibody development in sickle cell disease patients from Brazil.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Red blood cell alloimmunisation |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011502.1 |
| Locus Location: | 4839 |
| Size: | 1 bp |
| Located at: | CTLA4 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Oliveira VB, Dezan MR, Gomes FCA, Menosi Gualandro SF, Krieger JE, Pereira AC, Marsiglia JD, Levi JE, Rocha V, Mendrone-Junior A, Sabino EC, Dinardo CL, -318C/T polymorphism of the CTLA-4 gene is an independent risk factor for RBC alloimmunization among sickle cell disease patients., Int. J. Immunogenet. , 2017
Created on 2017-09-06 18:23:04,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.