
IthaID: 3257
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs231841 | HGVS Name: | NG_008935.1:g.262384G>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCCTGTGTTCGACATCCTTGGAGAA [A/C] ACAACAACAAAGGCTGGGAGACAGC (Strand: -)
Comments: SNP (C allele) associated with elevated Hb A2 levels in Chinese β-thalassaemia carriers.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_008935.1 |
| Locus Location: | 262384 |
| Size: | 1 bp |
| Located at: | KCNQ1 |
| Specific Location: | Intron 11 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Yu S, Chen Y, Lai K, Dewan RK, He Y, A Novel Variant with Positive Natural Selection Influenced Hb A2 Levels in Chinese Individuals with β-Thalassemia., Hemoglobin , 2017
Created on 2017-09-11 19:11:01,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.