IthaID: 3257

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs231841 HGVS Name: NG_008935.1:g.262384G>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCCTGTGTTCGACATCCTTGGAGAA [A/C] ACAACAACAAAGGCTGGGAGACAGC (Strand: -)

Comments: SNP (C allele) associated with elevated Hb A2 levels in Chinese β-thalassaemia carriers.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 11
Locus: NG_008935.1
Locus Location: 262384
Size: 1 bp
Located at: KCNQ1
Specific Location: Intron 11

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Yu S, Chen Y, Lai K, Dewan RK, He Y, A Novel Variant with Positive Natural Selection Influenced Hb A2 Levels in Chinese Individuals with β-Thalassemia., Hemoglobin , 2017
Created on 2017-09-11 19:11:01, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.