
IthaID: 3285
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs11759328 | HGVS Name: | NC_000006.12:g.129691228C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAACATAAACACACACTTTCCCTAA [C/T] CTTATGCCTTGATAAAGACTACACA (Strand: +)
Comments: SNP associated with increased HbF levels in a Chinese cohort of patients with β-thalassaemia, as well as in Thai cohort with heterozygous and homozygous haemoglobin E (HbE).
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese, Thai |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- He Y, Luo J, Chen Y, Zhou X, Yu S, Jin L, Xiao X, Jia S, Liu Q, ARHGAP18 is a novel gene under positive natural selection that influences HbF levels in β-thalassaemia., Mol. Genet. Genomics , 2017
- Jomoui W, Tepakhan W, Yamsri S, Srivorakun H, Fucharoen G, Fucharoen S, A novel SNP rs11759328 on Rho GTPase-activating protein 18 gene is associated with the expression of Hb F in hemoglobin E-related disorders., Ann. Hematol., 99(1), 23-29, 2020
Created on 2017-12-14 17:35:21,
Last reviewed on 2020-07-02 09:12:22 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.