
IthaID: 3333
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | CD 137 ACC>ACT | HGVS Name: | HBA2:c.414C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGGCTTCTGTGAGCACCGTGCTGAC [C/T] TCCAAATACCGTTAAGCTGGAGCCT (Strand: +)
Comments: Silent mutation found in a non-thalassemic relative of a patient.
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34448 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Dutch |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Harteveld KL, Heister AJ, Giordano PC, Losekoot M, Bernini LF, Rapid detection of point mutations and polymorphisms of the alpha-globin genes by DGGE and SSCA., Hum. Mutat. , 7(2), 114-22, 1996
Created on 2018-05-16 18:54:03,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.