IthaID: 3339

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2146323 HGVS Name: NG_008732.1:g.12143C>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGACTTACGTTAGATTTTGGAAGGA [A/C] TTGCCTGATTCGGAAGCTCCAAAGA (Strand: +)

Comments: SNP (C>A) strongly associated with high HbF levels in β-thalassaemia patients and hence, a milder clinical phenotype of the disease. The A allele also associated with hydroxyurea treatment efficacy (high HbF levels) in SCD/β-thalassaemia patients.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Location

Chromosome: 6
Locus: NG_008732.1
Locus Location: 12143
Size: 1 bp
Located at: VEGFA
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Chondrou V, Kolovos P, Sgourou A, Kourakli A, Pavlidaki A, Kastrinou V, John A, Symeonidis A, Ali BR, Papachatzopoulou A, Katsila T, Patrinos GP, Whole transcriptome analysis of human erythropoietic cells during ontogenesis suggests a role of VEGFA gene as modulator of fetal hemoglobin and pharmacogenomic biomarker of treatment response to hydroxyurea in β-type hemoglobinopathy patients., Hum. Genomics , 11(1), 24, 2017
Created on 2018-06-25 17:13:27, Last reviewed on 2019-05-20 16:10:28 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.