IthaID: 3400
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 147 TAA>CAA [Stop>Gln] | HGVS Name: | HBB:c.442T>C |
Hb Name: | Hb Zunyi | Protein Info: | β 147, Stop>Gln; modified C-terminal sequence: (147)Gln-Ala-Arg-Phe-Leu-Ala-Val-Gln-Phe-Leu-Leu- Lys-Val-Pro-Leu-Phe-Pro-Lys-Ser-Asn-(167)Tyr-COOH |
Context nucleotide sequence:
CTAATGCCCTGGCCCACAAGTATCAC [T/C] AAGCTCGCTTTCTTGCTGTCCAA (Strand: -)
Also known as:
Comments: Reported as a de novo mutation in a young transfusion-dependent patient with severe hemolytic anaemia. This mutation results in a stop-codon substitution to a glutamine residue and an increase of 21 amino-acids in the beta-globin chain. Leads to a dominant beta-thalassemia state according to this case report.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
Allele Phenotype: | Dominant |
Stability: | Hyperunstable |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72016 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Nonsense codon (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Dominant |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Su Q, Chen S, Wu L, Tian R, Yang X, Huang X, Chen Y, Peng Z, Chen J, Severe Thalassemia Caused by Hb Zunyi [β147(HC3)Stop→Gln; : c.442T>C)] on the β-Globin Gene., Hemoglobin, 43(1), 7-11, 2019
Created on 2019-04-11 16:33:29,
Last reviewed on 2023-07-03 15:36:03 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2019-04-11 16:33:29 | The IthaGenes Curation Team | Created |
2 | 2019-06-11 09:38:03 | The IthaGenes Curation Team | Reviewed. Reference added. |
3 | 2020-11-11 11:57:50 | The IthaGenes Curation Team | Reviewed. Context Sequence corrected. |
4 | 2023-07-03 15:36:03 | The IthaGenes Curation Team | Reviewed. Inheritance corrected |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02