
IthaID: 3410
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs9494142 | HGVS Name: | NC_000006.12:g.135110502T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTCTCAGTCAATTCGATTCTACTACTGACA [T>C] TTATCAACATGGTGGGTGTGATATCTTTTA (Strand: +)
Comments: SNP is located within an enhancer-like regulatory sequence 71 kb upstream of the MYB transcriptional start site (-71 LDB1 complex binding site) adjacent to a GATA1 motif. The rs9494142 C allele disrupts a stretch of 3 A/T residues adjacent to the “TATC” core GATA1 motif, affecting long-range MYB regulation [PMID: 24614105]. SNP associated with elevated HbF levels in African-Americans (CSSCD cohort) [PMID: 21057501] and Cameroonians [PMID: 24667352] with sickle-cell disease (SCD), as well as in Chinese cohorts with β-thalassaemia [PMID: 18697826, 22023465, 27835778, 28361591]. An association with a HbF level > 40% was detected in β-thalassaemia patients from the Eastern Province of Saudi-Arabia [PMID: 28280727]. The association with HbF levels was not replicated in healthy Chinese subjects [PMID: 18697826] or in SCD cohorts of African-Caribbean (Jamaican, Trinidanian) or West African (Nigerian, Ghanaian, Sierra Leonean) descent [PMID: 21068433]. Also, SNP associated with F cell levels in families of Northern European ancestry (Twins U.K. Adult Twin Registry) [PMID: 17592125]. The association signal varied across healthy African-descended populations from Jamaica and was detected in European expatriates and the Afro-German cohort. The association with F cell numbers was not replicated in healthy Afro-Caribbean subjects or in patients with sickle cell anaemia of African origin [PMID: 19148297].
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers |
Location
Chromosome: | 6 |
---|---|
Locus: | NT_025741.15 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | HBS1L-MYB |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African-American, Chinese, Northern Europeans, Jamaican, Cameroonian, Saudi |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007
- So CC, Song YQ, Tsang ST, Tang LF, Chan AY, Ma ES, Chan LC, The HBS1L-MYB intergenic region on chromosome 6q23 is a quantitative trait locus controlling fetal haemoglobin level in carriers of beta-thalassaemia., J. Med. Genet. , 45(11), 745-51, 2008
- Creary LE, Ulug P, Menzel S, McKenzie CA, Hanchard NA, Taylor V, Farrall M, Forrester TE, Thein SL, Genetic variation on chromosome 6 influences F cell levels in healthy individuals of African descent and HbF levels in sickle cell patients., PLoS ONE, 4(1), e4218, 2009
- Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010
- He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
- Makani J, Menzel S, Nkya S, Cox SE, Drasar E, Soka D, Komba AN, Mgaya J, Rooks H, Vasavda N, Fegan G, Newton CR, Farrall M, Thein SL, Genetics of fetal hemoglobin in Tanzanian and British patients with sickle cell anemia., Blood, 117(4), 1390-2, 2011
- Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014
- Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014
- Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016
- Lai Y, Chen Y, Chen B, Zheng H, Yi S, Li G, Wei H, He S, Zheng C, Genetic Variants at BCL11A and HBS1L-MYB loci Influence Hb F Levels in Chinese Zhuang β-Thalassemia Intermedia Patients., Hemoglobin, 40(6), 405-410, 2016
- Cyrus C, Vatte C, Borgio JF, Al-Rubaish A, Chathoth S, Nasserullah ZA, Jarrash SA, Sulaiman A, Qutub H, Alsaleem H, Alzahrani AJ, Steinberg MH, Ali AK, Existence of HbF Enhancer Haplotypes at Intergenic Region in Transfusion-Dependent Saudi -Thalassemia Patients., Biomed Res Int, 2017(0), 1972429, 2017