IthaID: 3416
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs12477097 | HGVS Name: | NG_011968.1:g.87237T>G |
Context nucleotide sequence:
CTCTGCTTCCCCTGCAGAATTAGACAGCTA [A>C] AAACATTTCTATCAGCCTAAGAAGCTATTT (Strand: +)
Also known as:
Comments: SNP associated with HbF levels (positive effect) in Chinese β-thalassaemia heterozygotes [PMID: 21385855]. SNP was found to have a significant effect on HbF levels in a meta-analysis of many GWAS with a total of 2040 sickle cell anaemia patients from 7 cohorts (e.g., CSSCD, MSH, PUSH, Walk-PHaSST and SIT) [PMID: 22936743].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_011968.1 |
Locus Location: | 87237 |
Size: | 1 bp |
Located at: | BCL11A |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese, African-American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011
- Bae HT, Baldwin CT, Sebastiani P, Telen MJ, Ashley-Koch A, Garrett M, Hooper WC, Bean CJ, Debaun MR, Arking DE, Bhatnagar P, Casella JF, Keefer JR, Barron-Casella E, Gordeuk V, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Hoppe C, Gladwin MT, Zhang Y, Steinberg MH, Meta-analysis of 2040 sickle cell anemia patients: BCL11A and HBS1L-MYB are the major modifiers of HbF in African Americans., Blood , 120(9), 1961-2, 2012
Created on 2019-05-23 17:08:26,
Last reviewed on 2019-05-24 09:44:27 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2019-05-23 17:08:26 | The IthaGenes Curation Team | Created |
2 | 2019-05-23 17:09:14 | The IthaGenes Curation Team | Reviewed. Ethnic origin added. |
3 | 2019-05-24 09:44:27 | The IthaGenes Curation Team | Reviewed. Inheritance mode corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02