IthaID: 3442
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 51-58 (+24 bp) | HGVS Name: | HBA1:c.157_180dupTCTGCCCAGGTTAAGGGCCACGGC |
Hb Name: | Hb Choisy | Protein Info: | N/A |
Context nucleotide sequence:
CCCGCACTTCGACCTGAGCCACGGC [-/TCTGCCCAGGTTAAGGGCCACGGC] AAGAAGGTGGCCGACGCGCTGACCA (Strand: +)
Also known as:
Comments: Insertion of eight amino acids (Ser-Ala-Gln-Val-Lys-Gly-His-Gly) due to a 24 bp duplication from nucleotide 157 to 180. The His(E7) residue appears to be in its normal position, while the eight additional residues are probably inserted at the beginning of helix E, increasing its size, but with mild effects on folding and heme contact.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | α-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37853 |
Size: | 24 bp |
Located at: | α1 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Wajcman H, de Brevern AG, Riou J, Latouche C, Marden MC, Pissard S, Short in-Frame Insertions/Deletions in the Coding Sequence of the α-Globin Gene. Consequences of the 3D Structure and Resulting Phenotypes: Hb Choisy as an Example., Hemoglobin, 42(0), 287-293, 2018
Created on 2019-08-01 16:08:22,
Last reviewed on 2019-08-01 16:09:25 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2019-08-01 16:08:22 | The IthaGenes Curation Team | Created |
2 | 2019-08-01 16:09:25 | The IthaGenes Curation Team | Reviewed. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02