
IthaID: 3544
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs1526083 | HGVS Name: | NG_050579.1:g.9354A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATTTGCATATGCACAGGCACTCCATTC [A>G] GTTGTCATCAAATGCCCTTTGTTCAGA (Strand: +)
Comments: SNP is significantly associated with development of ACS in patients (aged <5 years) with sickle cell anaemia. Source: Blood (2007) 110 (11): 2247; doi.org/10.1182/blood.V110.11.2247.2247
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Acute chest syndrome |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Fertrin KY, Costa FF, Genomic polymorphisms in sickle cell disease: implications for clinical diversity and treatment., Expert Rev Hematol , 3(4), 443-58, 2010
Created on 2019-12-13 12:07:13,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.