IthaID: 3550
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs3191333 | HGVS Name: | NG_033271.1:g.10912C>T |
Context nucleotide sequence:
CCACAGCCTGGCACGAAGGCCCCG [C>T] CTGGGTTAGGTGACTAAAAGGGC (Strand: -)
Also known as:
Comments: Thalassemia intermedia patients (CC) had significantly higher mean pretransfusion Hb after treatment with hydroxyurea (n=12). SCD patients (CC) had a significantly longer interval between transfusion before treatment with hydroxyurea (n=13) [PMID: 28085748]. SNV associated with persistent HbF levels in non-transfusion dependent beta-thalassaemia patients (18 cases, 85 healthy controls) [PMID: 31393228].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Response to hydroxyurea |
Location
Chromosome: | 8 |
---|---|
Locus: | NG_033271.1 |
Locus Location: | 10912 |
Size: | 1 bp |
Located at: | KLF10 |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Egyptian, Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Elalfy MS, El Sherif NH, Kamal TM, Aly NH, Klf10 Gene, a Secondary Modifier and a Pharmacogenomic Biomarker of Hydroxyurea Treatment Among Patients With Hemoglobinopathies., J. Pediatr. Hematol. Oncol. , 39(3), e155-e162, 2017
- Stratopoulos A, Kolliopoulou A, Karamperis K, John A, Kydonopoulou K, Esftathiou G, Sgourou A, Kourakli A, Vlachaki E, Chalkia P, Theodoridou S, Papadakis MN, Gerou S, Symeonidis A, Katsila T, Ali BR, Papachatzopoulou A, Patrinos GP, Genomic variants in members of the Krüppel-like factor gene family are associated with disease severity and hydroxyurea treatment efficacy in β-hemoglobinopathies patients., Pharmacogenomics, 20(11), 791-801, 2019
Created on 2019-12-18 18:07:52,
Last reviewed on 2020-04-30 19:54:56 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2019-12-18 18:07:52 | The IthaGenes Curation Team | Created |
2 | 2020-04-30 19:54:56 | The IthaGenes Curation Team | Reviewed. Variant context sequence, Comment, Phenotype, Ethnicity and Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-30 12:06:09