
IthaID: 3581
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1050829 | HGVS Name: | NG_009015.2:g.17296A>T | NG_009015.2:g.17296A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTACCAGCGCCTCAACAGCCACATG [A/G/T] ATGCCCTCCACCTGGGGTCACAGGCC (Strand: -)
Comments: SNP associated with MRA-defined cerebral vasculopathy in pediatric male patients with SCA from the Silent Infarct Transfusion (SIT) Trial. G6PD enzyme activity is decreased by about 30% when this variation is present.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | X |
|---|---|
| Locus: | NG_009015.2 |
| Locus Location: | 17296 |
| Size: | 1 bp |
| Located at: | G6PD |
| Specific Location: | Exon 5 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Thangarajh M, Yang G, Fuchs D, Ponisio MR, McKinstry RC, Jaju A, Noetzel MJ, Casella JF, Barron-Casella E, Hooper WC, Boulet SL, Bean CJ, Pyle ME, Payne AB, Driggers J, Trau HA, Vendt BA, Rodeghier M, DeBaun MR, Magnetic resonance angiography-defined intracranial vasculopathy is associated with silent cerebral infarcts and glucose-6-phosphate dehydrogenase mutation in children with sickle cell anaemia., Br. J. Haematol., 159(3), 352-9, 2012
Created on 2020-03-25 20:32:46,
Last reviewed on 2020-03-30 16:09:13 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.