
IthaID: 3590
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs33389 | HGVS Name: | NG_009062.1:g.119579G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTATTATTGCTTCTGCTTAAAACTC [G>A] CATCCCCTAATGCAAGCCTGAGCA (Strand: -)
Comments: The TT and CT genotypes associated with increased health care utilization for acute pain in an African-American cohort with sickle cell disease. No association with chronic pain as deduced by Composite Pain Index (CPI). Though there is a strong linkage disequilibrium among the three NR3C1 variants (rs33389, rs2963155 and rs9324918), they do not form a haploblock.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pain [HP:0012531] |
Location
| Chromosome: | 5 |
|---|---|
| Locus: | NG_009062.1 |
| Locus Location: | 119579 |
| Size: | 1 bp |
| Located at: | NR3C1 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Jhun EH, Sadhu N, Yao Y, He Y, Molokie RE, Wilkie DJ, Wang ZJ, Glucocorticoid receptor single nucleotide polymorphisms are associated with acute crisis pain in sickle cell disease., Pharmacogenomics, 19(13), 1003-1011, 2018
Created on 2020-05-19 12:17:09,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.