IthaID: 3592

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9324918 HGVS Name: NG_009062.1:g.52918A>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGTCATTTAAGAATGAACTGCTCTA [A>G] TGTTCAGGAAAAAAGAGGGGAGGG (Strand: -)

Comments: The C allele associated with increased health care utilization for acute pain in an African-American cohort with sickle cell disease. No association with chronic pain as deduced by Composite Pain Index (CPI). Though there is a strong linkage disequilibrium among the three NR3C1 variants (rs33389, rs2963155 and rs9324918), they do not form a haploblock.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]

Location

Chromosome: 5
Locus: NG_009062.1
Locus Location: 52918
Size: 1 bp
Located at: NR3C1
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Jhun EH, Sadhu N, Yao Y, He Y, Molokie RE, Wilkie DJ, Wang ZJ, Glucocorticoid receptor single nucleotide polymorphisms are associated with acute crisis pain in sickle cell disease., Pharmacogenomics, 19(13), 1003-1011, 2018
Created on 2020-05-19 12:35:02, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.