
IthaID: 3620
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs9983698 | HGVS Name: | NC_000021.9:g.46598630C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCTGCGCTCTTTTTATTGAA [C>T] GCAGGCCCTCGCGGTGGCT (Strand: +)
Comments: The T allele showed trend for association with an increase in pain (CPI) scores in a sickle cell disease cohort consisting mainly of African-Americans.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Pain [HP:0012531] |
Location
| Chromosome: | 21 |
|---|---|
| Locus: | NM_006272.3 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | S100B |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Jhun EH, Sadhu N, He Y, Yao Y, Wilkie DJ, Molokie RE, Wang ZJ, S100B single nucleotide polymorphisms exhibit sex-specific associations with chronic pain in sickle cell disease in a largely African-American cohort., PLoS ONE, 15(5), e0232721, 2020
Created on 2020-09-08 10:27:57,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.