
IthaID: 3625
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2154586 | HGVS Name: | NC_000021.9:g.46603603G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTACCAGCTTTTGGCCTTGA [G>A] TTCTAATCATTAAATAAGAA (Strand: +)
Comments: The 'A' allele associated with avascular necrosis in adult (Walk-PHaSST) and pediatric (PUSH) cohorts with sickle cell disease.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] |
Location
Chromosome: | 21 |
---|---|
Locus: | NM_006272.3 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | S100B |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Zhang X, Shah BN, Zhang W, Saraf SL, Nouraie M, Nekhai S, Machado RF, Gladwin MT, Gordeuk VR, S100B has pleiotropic effects on vaso-occlusive manifestations in sickle cell disease., Am. J. Hematol., 95(3), E62-E65, 2020
Created on 2020-09-08 12:26:33,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.