IthaID: 3636


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 104 (-A) HGVS Name: HBB:c.313delA
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGCACGTGGATCCTGAGAACTTC [A/-] GGGTGAGTCTATGGGACGCTTGA (Strand: -)

Also known as:

Comments: Found in a 12-year-old Chinese boy in compound heterozygosity with HBB:c.126_129delCTTT [IthaID:147] and the -α4.2 [IthaID:301]. Patient presented with severe β-thalassemia and required regular blood transfusions. The A deletion caused a frameshift at codon 104, which resulted in an elongated protein of 156 amino acid residues.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71037
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Qiu Y, Huang Y, Chen P, Wei S, Su Q, Zhang Z, Yang Z, Ye L, Huang J, Shen X, Mo W, Compound Heterozygosity for a Novel Mutation Codon 104 (-A) (: c.313delA) and Codons 41/42 (-CTTT) (: c.126_129delCTTT) Leading to β-Thalassemia Major in a Chinese Family., Hemoglobin, 2020
  2. Lin W, Zhang Q, Shen Z, Qu X, Wang Q, Wei L, Qiu Y, Yang J, Xu X, Lao J, Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA., Int J Lab Hematol, 43(6), 1620-1627, 2021

Microattributions

A/AContributor(s)DateComments
1Qiu, Yuling2020-09-07First report.
Created on 2020-10-02 09:39:52, Last reviewed on 2021-12-22 15:22:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.