
IthaID: 3655
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs1001179 | HGVS Name: | NG_013339.2:g.4760C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GAGCCCCGCCCTGGGTTCGGCTAT [C>T] CCGGGCACCCCGGGCCGGCGGGG (Strand: +)
Comments: 2KB Upstream Variant; Associated with response to hydroxyurea treatment in patients with sickle cell anaemia based on observed alterations in laboratory biomarkers, including hemolytic and inflammatory parameters.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Response to hydroxyurea |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_013339.2 |
Locus Location: | 4760 |
Size: | 1 bp |
Located at: | CAT |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Yahouédéhou SCMA, Neres JSDS, da Guarda CC, Carvalho SP, Santiago RP, Figueiredo CVB, Fiuza LM, Ndidi US, de Oliveira RM, Fonseca CA, Nascimento VML, Rocha LC, Adanho CSA, da Rocha TSC, Adorno EV, Goncalves MS, Sickle Cell Anemia: Variants in the , , and Genes Are Associated With Improved Hydroxyurea Response., Front Pharmacol, 11(0), 553064, 2020
Created on 2020-10-13 12:47:44,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.