
IthaID: 3658
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1949857 | HGVS Name: | NC_000007.14:g.71006906C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCATTTTTATTATTTGGTTGCTCAG [C>T] ATTGAAGGAAAAGGAATGGGCTT (Strand: +)
Comments: Intergenic variant. Associated with F-cell levels in a pediatric cohort with sickle cell anaemia from the Silent Cerebral Infarct Transfusion (SIT) trial.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | F-cell numbers |
Location
| Chromosome: | 7 |
|---|---|
| Locus: | N/A |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | AUTS2-GALNT17 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011
Created on 2020-10-15 11:00:00,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.