
IthaID: 3698
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs16998911 | HGVS Name: | NG_016419.1:g.49280T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCAAGGACCATGTAGAATTTGTAA [T>C] GGACTTATCACCTACACAAATCAGT (Strand: +)
Comments: Significant association with high F cell numbers (in the range of 13 to 30%) and HbF levels (>4%) in males with sickle cell disease from Tanzania. The association was not replicated in female patients. rs16998911 is an X-linked determinant of Fcells% also explaining gender differences in F-cell distribution in SCD patients.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers |
Location
| Chromosome: | X |
|---|---|
| Locus: | NG_016419.1 |
| Locus Location: | 49280 |
| Size: | 1 bp |
| Located at: | FRMPD4 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Tanzanian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Urio F, Nkya S, Rooks H, Mgaya JA, Masamu U, Zozimus Sangeda R, Mmbando BP, Brumat M, Mselle T, Menzel S, Luzzatto L, Makani J, F cell numbers are associated with an X-linked genetic polymorphism and correlate with haematological parameters in patients with sickle cell disease., Br J Haematol, 2020
Created on 2020-11-12 13:26:57,
Last reviewed on 2020-11-12 13:27:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.