IthaID: 3698
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs16998911 | HGVS Name: | NG_016419.1:g.49280T>C |
Context nucleotide sequence:
CCCAAGGACCATGTAGAATTTGTAA [T>C] GGACTTATCACCTACACAAATCAGT (Strand: +)
Also known as:
Comments: Significant association with high F cell numbers (in the range of 13 to 30%) and HbF levels (>4%) in males with sickle cell disease from Tanzania. The association was not replicated in female patients. rs16998911 is an X-linked determinant of Fcells% also explaining gender differences in F-cell distribution in SCD patients.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers |
Location
Chromosome: | X |
---|---|
Locus: | NG_016419.1 |
Locus Location: | 49280 |
Size: | 1 bp |
Located at: | FRMPD4 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Tanzanian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Urio F, Nkya S, Rooks H, Mgaya JA, Masamu U, Zozimus Sangeda R, Mmbando BP, Brumat M, Mselle T, Menzel S, Luzzatto L, Makani J, F cell numbers are associated with an X-linked genetic polymorphism and correlate with haematological parameters in patients with sickle cell disease., Br J Haematol, 2020
Created on 2020-11-12 13:26:57,
Last reviewed on 2020-11-12 13:27:32 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2020-11-12 13:26:57 | The IthaGenes Curation Team | Created |
2 | 2020-11-12 13:27:32 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-12 10:33:52