IthaID: 3705


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 72 (+C) HGVS Name: HBA2:c.217dup
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GACGCGCTGACCAACGCCGTGGCGC [-/C] ACGTGGACGACATGCCCAACGCGCTG (Strand: +)

Also known as:

Comments: Found in a heterozygous state in an individual from the Baoan Region in southern China.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34109
Size: 1 bp
Located at: α2
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Yu Y, Yang Z, Yu H, Sun R, Zhu Y, Guo F, High prevalence of thalassemia with a novel α-thalassemia mutationin in Baoan populations in Guangdong province, China., Eur J Obstet Gynecol Reprod Biol, 2020
Created on 2020-11-17 17:17:54, Last reviewed on 2020-11-17 17:39:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.