
IthaID: 3706
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1160065459 | HGVS Name: | NC_000019.10:g.10148923G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTGTTGGCTGGGTTTTTGGAGGG [G>A] ACTCGAATCTCGCGTAGTCTTGA (Strand: +)
Comments: Associated with high HbF production by epigenetically de-repressing γ-globin expression and amelioration of disease severity in a Chinese cohort of β-thalassaemia.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_028016.3 |
| Locus Location: | 87364 |
| Size: | 1 bp |
| Located at: | DNMT1 |
| Specific Location: | Exon 27 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gong Y, Zhang X, Zhang Q, Zhang Y, Ye Y, Yu W, Shao C, Yan T, Huang J, Zhong J, Wang L, Li Y, Wang L, Xu X, A natural DNMT1 mutation elevates the fetal hemoglobin via epigenetic de-repression of γ-globin gene in β-thalassemia., Blood, 2020
Created on 2020-12-01 13:20:29,
Last reviewed on 2020-12-01 13:20:57 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.