
IthaID: 3743
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs12289259 | HGVS Name: | NC_000011.10:g.72735686A>C | NC_000011.10:g.72735686A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACAGATTGATAGATGACGGTCCCAGC [A/C/G] ACCCCACTGGAATGACCAGGTCTGGG (Strand: +)
Comments: Allele 'A' associated with alloimmune responder status in an African American cohort of multiply transfused sickle cell disease patients.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Red blood cell alloimmunisation |
Location
Chromosome: | 11 |
---|---|
Locus: | NM_001040118.3 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | ARAP1 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hanchard NA, Moulds JM, Belmont JW, Chen A, A Genome-Wide Screen for Large-Effect Alloimmunization Susceptibility Loci among Red Blood Cell Transfusion Recipients with Sickle Cell Disease., Transfus Med Hemother, 41(6), 453-61, 2014
Created on 2021-02-17 15:56:11,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.