IthaID: 3784


Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: CD 133 GTG>GTC [Val>Val] HGVS Name: HBB:c.402G>C

Context nucleotide sequence:
ATGGCGCCTTCCTCTCAGGGCAG [G/C] GGATCACGCGGGTTGCGGGAGGT (Strand: -)

Also known as:

Comments: Variation is reported in ClinVar as Conflicting interpretations of pathogenicity Benign(1);Likely benign(3);Uncertain significance(4) with an 1-star review status (criteria provided, conflicting interpretations).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71976
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Pianezze G, Toniolo M, Taddei Masieri M, Dolcini B, Ravani A, Hb Belluno [β111(G13)Val→Gly;β133(H11)Val→Val (HBB: c.335T > G;402G > C)]: Incidental Detection of a New Clinically Silent β Chain Variant During Hb A1c Determination by High Performance Liquid Chromatography., Hemoglobin , 40(3), 143-9, 2016
  2. Carlice-Dos-Reis T, Viana J, Moreira FC, Cardoso GL, Guerreiro J, Santos S, Ribeiro-Dos-Santos Â, Investigation of mutations in the HBB gene using the 1,000 genomes database., PLoS One, 12(4), e0174637, 2017
Created on 2021-04-05 13:01:33, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.