IthaID: 3817


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 4 (-T) HGVS Name: HBB:c.14delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
ACAGACACCATGGTGCATCTGA [C/-] TCCTGAGGAGAAGTCTGCCGTT (Strand: -)

Protein sequence:
MVHLILRRSLPLLPCGAGX

Also known as:

Comments: Found in a 31-year old male and his mother presented with decreased levels of MCV, MCH and increased level of HbA2.Τhe C deletion, causing a frameshift that introduces a premature stop codon fourteen amino acids further down the new reading frame.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70608
Size: 1 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Chen J, Lin S, Gan J, Xin X, Huang J, A novel β-thalassemia variant at HBB:c.14delC (Codon 4, -C) identified via next-generation sequencing., Hematology, 25(1), 400-404, 2020
Created on 2021-07-12 13:01:52, Last reviewed on 2021-07-12 13:03:00 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.