
IthaID: 3899
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs3770138 | HGVS Name: | NC_000002.12:g.181461180C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCATATGGTATATTCATGCCATAAG [C>T] AGAAGTGAGCCTGCCTGTTTATCTAGA (Strand: +)
Comments: rs3770138-T showed a positive association with overt ischemic stroke in pediatric patients with sickle cell anemia of sub-Saharan African ancestry in Portugal.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_050623.1 |
| Locus Location: | 9289 |
| Size: | 1 bp |
| Located at: | ITGA4 |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | sub-Saharan African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Silva M, Vargas S, Coelho A, Ferreira E, Mendonça J, Vieira L, Maia R, Dias A, Ferreira T, Morais A, Soares IM, Lavinha J, Silva R, Kjöllerström P, Faustino P, Biomarkers and genetic modulators of cerebral vasculopathy in sub-Saharan ancestry children with sickle cell anemia., Blood Cells Mol Dis, 83(0), 102436, 2020
Created on 2022-03-24 11:37:41,
Last reviewed on 2022-03-24 11:42:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.