IthaID: 3921
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs964184 | HGVS Name: | NC_000011.10:g.116778201G>C |
Context nucleotide sequence:
TAATCACCATCTGATGTACTGTTTTCCT [G>C] ATCTGTTTATTGTCATTTTTCCCCACTAG (Strand: +)
Also known as:
Comments: The G allele associated with increased levels of triglycerides (TG) in children over 10 years old and the atherogenic ratio TG/HDL-C in a cohort of SCD.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NM_003904.5 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | ZPR1 |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Valente-Frossard TNS, Cruz NRC, Ferreira FO, Belisario AR, Pereira BM, Gomides AFF, Resende GAD, Carlos AM, Moraes-Souza H, Velloso-Rodrigues C, Polymorphisms in genes that affect the variation of lipid levels in a Brazilian pediatric population with sickle cell disease: rs662799 APOA5 and rs964184 ZPR1., Blood Cells Mol Dis, 80(0), 102376, 2020
Created on 2022-05-09 17:37:52,
Last reviewed on (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2022-05-09 17:37:52 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-29 12:50:12