IthaID: 3926


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -17 (A>G) HGVS Name: HBB:c.-67A>G
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCAGGGCTGGGCATAAAAGTCAGGGC [A>G] GAGCCATCTATTGCTTACATTTGCTTCT (Strand: -)

Also known as:

Comments: Detected during thalassaemia screening in a Vietnamese cohort with microcytic hypochromic anemia.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70528
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Vietnamese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Xinh PT, Chuong HQ, Ha NTT, Tram HDB, Van Dong C, Thanh LVH, Hoa NTH, Nghia H, Binh NT, Dung PC, Vu HA, Spectrum of HBB gene mutations among 696 β-thalassemia patients and carriers in Southern Vietnam., Mol Biol Rep, 49(4), 2601-2606, 2022
Created on 2022-05-11 16:08:33, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.