IthaID: 4021


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2209331 HGVS Name: NC_000006.12:g.136121468G>A

Context nucleotide sequence:
TCTTGGAAAAGACCAGAAAGCTAAAAAT [G>A] TATTTTTAGAAAGTCCTCCTTGGAAGACC (Strand: +)

Also known as:

Comments: AG was associated with an average increase of 3% and GG with an average increase of 11% in HbF following treatment with hydroxyurea (OR 1.6 and 7.5, p=0.05 and 0.000) [http://doi.org/10.1182/blood.V104.11.108.108].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 6
Locus: NG_011994.1
Locus Location: 274773
Size: 1 bp
Located at: PDE7B
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2023-04-03 09:58:20, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.