IthaID: 1356

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 16 GGC>CGC HGVS Name: HBD:c.49G>C
Hb Name: Hb A2' or Hb B2 Protein Info: δ 16(A13) Gly>Arg
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GAAGACTGCTGTCAATGCCCTGTGG [C/G] GCAAAGTGAACGTGGATGCAGTTGG (Strand: -)

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63231
Size: 1 bp
Located at: δ
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

HPLC

Disclaimer: The HPLC images are provided as an information resource only. Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes. D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission. Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc. To access HPLC images and reports for different variants, use the IthaChrom tool.
ID Hb Variant Gene Instrument Method Area (%) Ret Time (min) Comments
552Hb A2' or Hb B2δD-10Dual Kit Program1.54.19[PDF]
553Hb A2' or Hb B2δVARIANTβ-thal Short Program1.54.47[PDF]
554Hb A2' or Hb B2δVARIANT IIβ-thal Short Program4.550.9Homozygous.[PDF]
555Hb A2' or Hb B2δVARIANT IIDual Kit Program0.83.62Homozygous.[PDF]

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Codrington JF, Li HW, Kutlar F, Gu LH, Ramachandran M, Huisman TH, Observations on the levels of Hb A2 in patients with different beta-thalassemia mutations and a delta chain variant., Blood, 76(6), 1246-9, 1990
Created on 2010-06-16 16:13:17, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.