Loading... Please wait!
Quick filtering
Showing all entries in locus NG_000007.3 (Show All):
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
2159 | (εγδβ)0 with α triplication | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | |
2418 | Swiss (εγδβ)0 | N/A | NC_000011.10:g.(4002734_4002784)_ (6907712_6907762)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
2548 | Inv-Del English V | N/A | NC_000011.10:g.5194460_5253454invdel5194460_5194542del5253454_5375965 | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
3112 | African II duplication | N/A | NC_000011.10:g.5268938_5268939ins4619102_(5180070_5183700)ins(5216190_5222040)_5268938 | ε, Aγ, Gγ, δ, β, pseudo β | Neutral | N/A | NG_000007.3 | |
3393 | 3.5 kb deletion (Thai, 3485 bp deletion) | N/A | NC_000011.10:g.5224302_5227791del3490bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
3435 | Gγ-Atlanta HPFH (Atlanta type of HPFH, Atlanta non-deletional HPFH) | N/A | N/A | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | |
3436 | Yugoslavian non-deletional HPFH | N/A | N/A | Aγ, Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | |
3570 | 1.78Mb εγδβ(0) del (Bedouin) | N/A | NC_000011.10:g.(4302665_4322227)_(6099443_6100105)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
3578 | 2.2 Mb deletion | N/A | NC_000011.10:g.4052720_6253287del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
3606 | 177 Kb deletion | N/A | NC_000011.10:g.5241050_5418009del | βLCR, ε, Aγ, Gγ, pseudo β, OR51B5, OR51B6, OR51M1, OR51B2 | Causative | εγδβ-thalassaemia | NG_000007.3 | |
3826 | rs6578598 | N/A | NC_000011.10:g.5297978A>G | OR51AB1P-OR51B4 | Modifier | Severity | NG_000007.3 | |
3828 | rs449937 | N/A | NC_000011.10:g.5469115G>A | OR51B5 | Modifier | Severity | NG_000007.3 | |
3881 | rs3759071 | N/A | NC_000011.10:g.5270302G>A | NC_000011.10:g.5270302G>T | ε | Modifier | Hb F levels | NG_000007.3 | |
3882 | rs3813726 | N/A | NC_000011.10:g.5234759T>A | NC_000011.10:g.5234759T>C | δ | Modifier | Hb F levels | NG_000007.3 | |
3955 | Siriraj I Gγ(Aγδβ)0 (~118 kb del) | N/A | N/A | Aγ, δ, β | Causative | δβ-thalassaemia | NG_000007.3 | |
1400 | Hb Lepore-Leiden | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | ||
1404 | (Hb Anti-Lepore Hong Kong) | Hb Hong Kong | NG_000007.3:g.63160_70572dup | δ, β | Causative | δ-chain variant | NG_000007.3 | |
1405 | (Hb Anti-Lepore P-Nilotic) | Hb P-Nilotic | NG_000007.3:g.63461_70874dup | δ, β | Causative | δ-chain variant | NG_000007.3 | |
1525 | Belgian (Aγδβ)0 | N/A | NC_000011.10:g.(5200077_5215844)_(5249806_5251160)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | |
1540 | Hispanic (εγδβ)0 | N/A | NC_000011.10:g.5279573_5319355del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | |
1542 | Dutch I (εγδβ)0 | N/A | NC_000011.10:g.5229432_5329263del | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
1549 | Dutch IV | N/A | NC_000011.10:g.(5245669_5248365)_(5440251_5470849)del | βLCR, ε, Aγ, Gγ, OR51B5, OR51B6 | Causative | εγδβ-thalassaemia | NG_000007.3 | |
1550 | Dutch V | N/A | NC_000011.10:g.(5269965_5275919)_(5409809_5430375)del | βLCR, OR51B5, OR51B6, OR51M1, OR51B2, OR51B4 | Causative | εγδβ-thalassaemia | NG_000007.3 | |
291 | Czech (4237 bp deletion) | N/A | NG_000007.3:g.67258_71501del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
293 | Cape Verdean | N/A | NG_000007.3:g.71548_79271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
294 | Asian Indian (10329 bp deletion) | N/A | NG_000007.3:g.(67531_67533)_(77874_77876)del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
295 | Australian (Anglo Saxon) (12023 bp deletion) | N/A | NC_000011.10:g.5215894_5227926del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
299 | Italian (~67 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
1502 | Italian 1 (HPFH-4) | N/A | N/A | δ, β | Causative | HPFH, Hb F levels | NG_000007.3 | 0 |
1503 | Italian 2, Sicilian (HPFH-5) | N/A | NC_000011.10:g.59893_72818del | δ, β | Causative | HPFH, Hb F levels | NG_000007.3 | 0 |
1511 | East European (δβ)0 | N/A | NG_000007.3:g.61566_70708del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1514 | Macedonian/Turkish (δβ)0 (Turkish type 2 (δβ)0 | Turkish Inv/Del (δβ)0) | N/A | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1515 | Turkish (δβ)0 (Turkish type 3 (δβ)0) | N/A | N/A | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1516 | Leiden 7.4 kb (δβ)0 | N/A | NG_000007.3:g.(59658_64667)_(72019_81668)del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1517 | Thai 11.3 (δβ)0 | N/A | NG_000007.3:g.60045_71313delinsTACATTAAGAGATACCTTAATG | δ, β | Causative | δβ-thalassaemia, Hb F levels | NG_000007.3 | 0 |
1518 | Japanese 2 (δβ)0 | N/A | NG_000007.3:g.52036_78987del | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1519 | Indian (Aγδβ)0 (inv) (Asian-Indian Inv/Del Gγ(Aγδβ)0) | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1521 | Cantonese (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1522 | Malaysian-1 (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1528 | Yunnanese (Aγδβ)0 | N/A | NC_000011.10:g.5182845_5249973del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1531 | Canadian (Aγδβ)0 | N/A | NC_000011.10:g.5196589_5251715delinsTA | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1532 | Leiden 69.5 | N/A | NC_000011.10:g.(5167906_5178684)_(5248184_5251232)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1533 | 49.3 kb Gγ(Aγδβ)0 Asian del | N/A | NC_000011.10:g.5201244_5250542del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1534 | Anglo-Saxon (εγδβ)0 | N/A | NC_000011.8:g.5204501_5300223del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1535 | Irish (εγδβ)0 | N/A | NC_000011.8:g.5110112_5312961del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1536 | Canadian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1537 | Scottish - Irish | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1538 | English I (εγδβ)0 | N/A | N/A | βLCR, ε, Gγ | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1539 | Mexican (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1541 | Croatian (εγδβ)0 | N/A | NC_000011.10:g.(5151491_5158092)_(5285862_5295096)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1543 | English II | N/A | NC_000011.10:g.5262849_5360616del | βLCR, ε | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1544 | English III | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1545 | English IV | N/A | NC_000011.10:g.5156866_5595894del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1546 | Chilean | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1547 | Dutch II | N/A | NC_000011.10:g.(?_4999945)_(5409809_5430440)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B5, OR51M1 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1548 | Dutch III | N/A | NC_000011.10:g.5248950_5360936delinsGGGAGACTGATATA | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1551 | Dutch VI | N/A | NC_000011.10:g.(?_5227218)_(5373082_5382848)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1552 | Japanese | N/A | NC_000011.10:g.4600605_6019332delinsCACTTGGTTATGATGTATT | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1553 | French | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2123 | 7719 bp deletion | N/A | NG_000007.3:g.71550_79270del7719 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
2158 | Pakistani I | N/A | NC_000011.10:g.5194461_5700474delins[250inv] | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2161 | French (εγδβ)0 insertion/deletion | N/A | NG_000007.3:g.7751_18905delins[13569_13579inv;13364_13549inv] | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2163 | Norwegian (εγδβ)0 | N/A | NC_000011.10:g.5228098_5358569del | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2167 | Asian Indian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2378 | CD 6 GAG>CAG [Glu>Gln] | Hb A2-Ramallah | HBD:c.19G>C | δ | Causative | δ-chain variant | NG_000007.3 | 0 |
2419 | Senegalese δ(0)β(+) | N/A | NG_000007.3:g.(63154_63209)_(70570_70625)del7417 | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 0 |
2497 | 49.98 kb (δβ)0 Indian del (HPFH-9) | N/A | NC_000011.10:g.5194285_5244267del | δ, β, pseudo β | Causative | HPFH, Hb F levels | NG_000007.3 | 0 |
2498 | 86.7 kb (Αγδβ)0 Indian del (HPFH-10) | N/A | NC_000011.10:g.5164124_5250830delinsTG | Aγ, δ, β, pseudo β | Causative | HPFH, Hb F levels | NG_000007.3 | 0 |
2550 | African I duplication | N/A | NC_000011.10: g.5372677_5372678insCACCTCCACTTdup5226885_5372677 | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Neutral | N/A | NG_000007.3 | 0 |
2551 | Austrian I | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
3073 | Italian (εγδβ)0 deletion | N/A | NC_000011.10:g.[5194397_5357192del;5194356_5194401insAGCTAAAGGTTTTGTAAATGCACCAATCAGCAATCTGTGTCTAACTC] | ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
3340 | Brazilian (εγδβ)0 | N/A | NC_000011.10:g.(5106498_5151836)_(5324046_5390135)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B2 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
3390 | βδβ hybrid | Hb Palencia | N/A | δ, β | Causative | β-chain variant | NG_000007.3 | 0 |
3825 | rs3888708 | N/A | NG_000007.3:g.466G>T | OR51AB1P-OR51B4 | Modifier | Severity | NG_000007.3 | 466 |
3824 | rs7933082 | N/A | NG_000007.3:g.2115C>G | OR51AB1P-OR51B4 | Modifier | Severity | NG_000007.3 | 2115 |
3577 | 59 Kb deletion | N/A | NC_000011.10:g.5236469_5295261del | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 2355 |
3935 | 12.4 kb Mediterranean deletion | N/A | NG_000007.3:g.2798_15161delinsAGAGCCCT | βLCR | Causative | β-thalassaemia | NG_000007.3 | 2798 |
2165 | Puerto Rican (εγδβ)0 | N/A | NG_000007.3:g.2904_25432del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 2904 |
3483 | CD 121 GAA>-AA | Hb Mahasarakham | HBB:c.364delG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 6394 |
3107 | rs4601817 | N/A | NG_000007.3:g.6445T>C | βLCR | Modifier | Hb F levels, Severity | NG_000007.3 | 6445 |
2812 | rs11036639 | N/A | NG_000007.3:g.8340T>G | βLCR | Modifier | Hb F levels, Severity | NG_000007.3 | 8340 |
2566 | Caribbean | N/A | NG_000007.3:g.8510_13369del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 8510 |
2950 | rs16912979 | N/A | NG_000007.3:g.9151A>G | βLCR | Modifier | Hb F levels | NG_000007.3 | 9151 |
3849 | ~72 kb εγδβ(0) del | N/A | NC_000011.10:g.(5200032_5215881)_(5288356_5295076)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 9260 |
2164 | Tennessean (εγδβ)0 | N/A | NG_000007.3:g.10054_21931del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 10054 |
3106 | rs11036634 | N/A | NG_000007.3:g.10118G>A | βLCR | Modifier | Hb F levels, Severity | NG_000007.3 | 10118 |
2479 | Toledo (1992 bp deletion) | N/A | NG_000007.3:g.11835_13826del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 11835 |
2792 | rs4910742 | N/A | NG_000007.3:g.12337C>T | βLCR | Modifier | Hb F levels, Abnormal red blood cell count | NG_000007.3 | 12337 |
3260 | rs7119428 | N/A | NG_000007.3:g.16766T>G | βLCR | Modifier | Hb F levels | NG_000007.3 | 16766 |
3261 | rs9736333 | N/A | NG_000007.3:g.16784A>G | βLCR | Modifier | Hb F levels | NG_000007.3 | 16784 |
3936 | Italian HS1 | N/A | NG_000007.3:g.21088_24120del | βLCR | Neutral | N/A | NG_000007.3 | 21088 |
2718 | rs7130110 | N/A | NG_000007.3:g.22742C>G | ε | Modifier | Hb F levels, Hb F response to hydroxyurea | NG_000007.3 | 22742 |
2813 | rs11036562 | N/A | NG_000007.3:g.24701G>T | ε | Modifier | Hb F levels, Severity | NG_000007.3 | 24701 |
3820 | rs3759069 | N/A | NG_000007.3:g.27016T>A | ε | Modifier | Severity | NG_000007.3 | 27016 |
2727 | rs3759070 | N/A | NG_000007.3:g.27218G>C | ε | Modifier | Hb F levels, Severity | NG_000007.3 | 27218 |
3270 | Chinese I (εγδβ)0 | N/A | NC_000011.10:g.5036736_5270337del | ε, Aγ, Gγ, δ, β, pseudo β, OR51V1 | Causative | εγδβ-thalassaemia | NG_000007.3 | 27279 |
3573 | rs3834466 | N/A | NG_000007.3:g.27282dup | β | Neutral | N/A | NG_000007.3 | 27282 |
3868 | >35.3 Kb deletion | N/A | NG_000007.3:g.(21655_27675)_(63032_64586)del | ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 27675 |
3185 | rs67385638 | N/A | NG_000007.3:g.28476G>C | ε | Modifier | Hb F levels | NG_000007.3 | 28476 |
3880 | rs72872549 | N/A | NC_000011.10:g.5268823C>T | ε | Modifier | Hb F levels | NG_000007.3 | 28793 |
2824 | rs4910740 | N/A | NG_000007.3:g.31556C>T | HBG2-HBE1 | Modifier | Hb F levels, Severity | NG_000007.3 | 31556 |
2814 | rs10837707 | N/A | NG_000007.3:g.32038A>G | HBG2-HBE1 | Modifier | Hb F levels, Severity | NG_000007.3 | 32038 |
3417 | rs4348933 (rs11036509) | N/A | NG_000007.3:g.33868T>C | NG_000007.3:g.33868T>G | HBG2-HBE1 | Modifier | Hb F levels | NG_000007.3 | 33868 |
3819 | rs7480802 | N/A | NG_000007.3:g.36338A>G | HBG2-HBE1 | Modifier | Severity | NG_000007.3 | 36338 |
3818 | rs10160820 | N/A | NG_000007.3:g.36389T>G | HBG2-HBE1 | Modifier | Severity | NG_000007.3 | 36389 |
2825 | rs10128653 | N/A | NG_000007.3:g.41385T>G | Gγ | Modifier | Hb F levels | NG_000007.3 | 41385 |
3869 | >29.5 Kb duplication | N/A | NG_000007.3:g.(27675_41485)_(71150_72080)dup | Aγ, Gγ, δ, β, pseudo β | Causative | β-thalassaemia | NG_000007.3 | 41485 |
3596 | Gγ duplication (-Gγ-Gγ-, HBG2 duplication) | N/A | NG_000007.3:g.(41526_42954)_(48036_49186)del | Gγ | Neutral | N/A | NG_000007.3 | 41526 |
3411 | rs2855121 | N/A | NG_000007.3:g.41555G>A | Gγ | Modifier | Hb F levels, Severity | NG_000007.3 | 41555 |
2826 | rs2855122 | N/A | NG_000007.3:g.41610G>A | Gγ | Modifier | Hb F levels | NG_000007.3 | 41610 |
2874 | rs2855123 | N/A | NG_000007.3:g.41768T>A | Gγ | Modifier | Hb F levels, Severity | NG_000007.3 | 41768 |
3816 | rs2011051 | N/A | NG_000007.3:g.42028C>A | Gγ | Modifier | Severity | NG_000007.3 | 42028 |
1554 | -567 T>G (Iranian non-deletional HPFH) | N/A | HBG2:c.-620T>G | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42268 |
3272 | -533 (-ATAAG) | N/A | HBG2:c.-533_-529delATAAG | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42302 |
1555 | -202 C>G (Black non-deletional HPFH) | N/A | HBG2:c.-255C>G | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42633 |
3943 | -200 (+CC) | N/A | HBG2:c.-253_-254dup | Gγ | Causative | HPFH | NG_000007.3 | 42634 |
1556 | -200 +C (Tunisian non-deletional HPFH) | N/A | HBG2:c.-253dup | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42635 |
2300 | -197 C>T | N/A | HBG2:c.-250c>T | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42638 |
1557 | -196 C>T (Greek non-deletional HPFH) | N/A | HBG2:c.-249C>T | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42639 |
1558 | -175 T>C (Black/Sardinian/British non-deletional HPFH) | N/A | HBG2:c.-228T>C | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42660 |
2127 | -158 C>T (XmnI, rs7482144) | N/A | NG_000007.3:g.42677C>T | Gγ | Modifier | Hb F levels, Pain, Hb F response to hydroxyurea, F-cell numbers, Anaemia, Severity | NG_000007.3 | 42677 |
3790 | -125 C>T | N/A | HBG2:c.-177C>T | Gγ | Causative | HPFH | NG_000007.3 | 42710 |
1559 | -114 C>G (Australian non-deletional HPFH) | N/A | HBG2:c.-167C>G | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42721 |
1560 | -114 C>A (Algerian non-deletional HPFH) | N/A | HBG2:c.-167C>A | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42721 |
1561 | -114 C>T (Japanese non-deletional HPFH) | N/A | HBG2:c.-167C>T | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42721 |
1562 | -110 A>C (Czech non-deletional HPFH) | N/A | HBG2:c.-163A>C | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42725 |
1563 | -109 G>T (Greek non-deletional HPFH) | N/A | HBG2:c.-162A>C | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42726 |
1564 | -37 A>T (Belgian non-deletional HPFH) | N/A | HBG2:c.-90A>T | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42798 |
3162 | rs1894397 | N/A | NG_000007.3:g.42859G>A | Gγ | Modifier | Hb F levels | NG_000007.3 | 42859 |
2449 | CD 1 GGT>AGT [Gly>Ser] | Hb F-Montchat | HBG2:c.4G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42891 |
1406 | CD 1 GGT>TGT | Hb F-Malaysia | HBG2:c.4G>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 42891 |
3319 | CD 1 GGT>GAT [Gly>Asp] | Hb F-Hayward | HBG2:c.5G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42892 |
1407 | CD 5 GAG>GGG | Hb F-Meinohama | HBG2:c.17A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 42904 |
1409 | CD 7 GAC>AAC | Hb F-Auckland | HBG2:c.22G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42909 |
1410 | CD 8 AAG>CAG or GAG | Hb F-Albaicin | HBG2:c.25A>C | HBG2:c.25A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 42912 |
1412 | CD 12 ACA>AGA [Thr>Arg] | Hb F-Heather | HBG2:c.38C>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 42925 |
3804 | CD 13 AGC>AGA [Ser>Arg] | Hb F-Millennium Park | HBG2:c.42C>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42929 |
1413 | CD 15 TGG>CGG | Hb F-Catalonia | HBG2:c.46T>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 42933 |
1414 | CD 16 GGC>CGC | Hb F-Melbourne | HBG2:c.49G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 42936 |
1415 | CD 17 AAG>AAC or AAT | Hb F-Clamart | HBG2:c.54G>C | HBG2:c.54G>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 42941 |
2149 | N/A (Hb Gγ-β Ulsan) | Hb Ulsan | NG_000007.3:g.42946_70654del | Aγ, Gγ, δ, β, pseudo β | Causative | β-chain variant | NG_000007.3 | 42946 |
1416 | CD 19 AAT>AAA or AAG | Hb F-Ouled Rabah | HBG2:c.60T>A | HBG2:c.60T>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 42947 |
1417 | CD 20 GTG>GCG | Hb F-Bron | HBG2:c.62T>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 42949 |
1418 | CD 21 GAA>AAA | Hb F-Saskatoon | HBG2:c.64G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42951 |
1419 | CD 21 GAA>CAA | Hb F-Fuchu | HBG2:c.64G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 42951 |
4099 | CD 22 GAT>CAT [Asp>His] | Hb F-Nancy | HBG2:c.67G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 42954 |
1420 | CD 22 GAT>GTT | Hb F-Granada | HBG2:c.68A>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 42955 |
1421 | CD 22 GAT>GGT | Hb F-Urumqi | HBG2:c.68A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 42955 |
3566 | CD 24 GGA>GAA [Gly>Glu] | Hb F-Wentzville | HBG2:c.74G>A | Gγ | Causative | γ-chain variant, Haemolytic anaemia | NG_000007.3 | 42961 |
1422 | CD 25 GGA>GAA | Hb F-Cosenza | HBG2:c.77G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42964 |
1423 | CD 26 GAA>AAA | Hb F-Oakland | HBG2:c.79G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42966 |
3322 | CD 28 CTG>ATG [Leu>Met] | Hb F-M Viseu | HBG2:c.85C>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 42972 |
1424 | CD 34 GTC>ATC | Hb F-Tokyo | HBG2:c.103G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43112 |
2428 | CD 37 TGG>GGG [Trp>Gly] | Hb F-Cobb II | HBG2:c.112T>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43121 |
1425 | CD 38 ACC>CCC | Hb F-Bonheiden | HBG2:c.115A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43124 |
1426 | CD 40 AGG>GGG | Hb F-Veleta | HBG2:c.121A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43130 |
1427 | CD 40 AGG>AAG | Hb F-Austell | HBG2:c.122G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43131 |
2427 | CD 41 TTC>CTC [Phe>Leu] | Hb F-Avellino | HBG2:c.124T>C | Gγ | Causative | γ-chain variant, Hb F levels | NG_000007.3 | 43133 |
1428 | CD 41 TTC>TCC | Hb F-Cincinnati | HBG2:c.125T>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43134 |
1429 | CD 44 AGC>CGC | Hb F-Lodz | HBG2:c.133A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43142 |
3608 | CD 50 (TCT>TGT);CD 75(ATA>ACA) | Hb F-Madrid | HBG2:c.[152C>G;227T>C] | Gγ | Causative | γ-chain variant | NG_000007.3 | 43161 |
1430 | CD 55 ATG>AGG | Hb F-Kingston | HBG2:c.167T>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43176 |
1431 | CD 59 AAA>CAA | Hb F-Sacromonte | HBG2:c.178A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43187 |
1432 | CD 59 AAA>GAA | Hb F-Emirates | HBG2:c.178A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43187 |
2552 | CD 59 AAA>AGA [Lys>Arg] | Hb F-Augusta GA | HBG2:c.179A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43188 |
1433 | CD 63 CAT>TAT | Hb F-M-Osaka | HBG2:c.190C>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 43199 |
3369 | CD 63 CAT>CTT [His>Leu] | Hb F-Circleville | HBG2:c.191A>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 43200 |
2471 | CD 64 GGC>GAC [Gly>Asp] | Hb F-Turritana | HBG2:c.194G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43203 |
1434 | CD 65 AAG>AAT or AAC | Hb F-Clarke | HBG2:c.198G>C | HBG2:c.198G>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 43207 |
1435 | CD 66 AAG>CAG | Hb F-Brooklyn | HBG2:c.199A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43208 |
1436 | CD 66 AAG>AGG | Hb F-Shanghai | HBG2:c.200A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43209 |
2435 | CD 67 GTG>ATG [Val>Met] (Hb F-Heuried) | Hb Toms River | HBG2:c.202G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43211 |
1437 | CD 72 GGA>CGA | Hb F-Minoo | HBG2:c.217G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43226 |
1438 | CD 73 GAT>GCT | Hb F-Joanopolis | HBG2:c.221A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43230 |
1439 | CD 75 ATA>GTA | Hb F-Coigneres | HBG2:c.226A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43235 |
1440 | CD 75 ATA>ACA | Hb F-Lesvos | HBG2:c.227T>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43236 |
1441 | CD 77 CAC>CGC | Hb F-Kennestone | HBG2:c.233A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43242 |
1442 | CD 79 GAT>CAT [Asp>His] | Hb F-Saint-Etienne | HBG2:c.238G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43247 |
3803 | CD 79 GAT>GGT [Asp>Gly] | Hb F-Northerly Island | HBG2:c.239A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43248 |
1443 | CD 80 GAT>AAT | Hb F-Marietta | HBG2:c.241G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43250 |
1444 | CD 80 GAT>TAT [Asp>Tyr] | Hb F-Paulinia | HBG2:c.241G>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 43250 |
3389 | CD 89 AGT>AAT [Ser>Asn] | Hb F-Careggi | HBG2:c.269G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43278 |
1445 | CD 92 CAC>TAC | Hb F-M-Fort Ripley | HBG2:c.277C>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 43286 |
2395 | CD 93 TGT>CGT [Cys>Arg] | Hb F-Monserrato-Sassari | HBG2:c.280T>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43289 |
1446 | CD 94 GAC>AAC | Hb F-Columbus-GA | HBG2:c.283G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43292 |
1447 | CD 97 CAT>CGT [His>Arg] | Hb F-Lyon | HBG2:c.293A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 43302 |
1448 | CD 101 GAG>CAG [Glu>Gln] | Hb F-Zheijang | HBG2:c.304G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43313 |
1449 | CD 101 GAG>AAG | Hb F-La Grange | HBG2:c.304G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43313 |
1450 | CD 102 AAC>ACC [Asn>Thr] | Hb F-Sarajevo | HBG2:c.308A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43317 |
1451 | CD 104 AAG>AAC | Hb F-Macedonia-II | HBG2:c.315G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 43324 |
2459 | CD 105 CTC>CAC [Leu>His] | Hb F-Brugine/Feldkirch | HBG2:c.317T>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 43326 |
3959 | HBG1-HBG2 deletion | N/A | NG_000007.3:g.43348_48271del | Aγ, Gγ | Neutral | N/A | NG_000007.3 | 43348 |
3815 | rs2070973 | N/A | NG_000007.3:g.43439A>G | Gγ | Modifier | Severity | NG_000007.3 | 43439 |
3161 | rs11036475 | N/A | NG_000007.3:g.43606C>T | Gγ | Modifier | Hb F levels | NG_000007.3 | 43606 |
3160 | rs11036474 | N/A | NG_000007.3:g.43668A>G | Gγ | Modifier | Hb F levels | NG_000007.3 | 43668 |
3835 | 78.9 kb Gγ(Aγδβ)0 del | N/A | NC_000011.10:g.5169895_5248821delins5216274_5216309 | Aγ, δ, β, pseudo β, OR52Z1-OR51V1 | Causative | δβ-thalassaemia | NG_000007.3 | 43875 |
2804 | rs2070972 | N/A | NG_000007.3:g.44129T>G | Gγ | Modifier | Hb F levels, Severity | NG_000007.3 | 44129 |
1452 | CD 108 AAT>AAA [Asn>Lys] | Hb F-Ube | HBG1:c.327T>A | HBG2:c.327T>A | Aγ or Gγ | Causative | γ-chain variant | NG_000007.3 | 44222, 49140 |
1453 | CD 117 CAT>CGT | Hb F-Malta-I | HBG2:c.353A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 44248 |
1454 | CD 118 TTC>CTC | Hb F-Calabria | HBG2:c.355T>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 44250 |
3891 | CD 119 GGC>CGC [Gly>Arg] | Hb F-Pill Hill | HBG2:c.358G>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 44253 |
1455 | CD 120 AAA>CAA | Hb F-Caltech | HBG2:c.361A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 44256 |
1456 | CD 121 GAA>AAA | Hb F-Carlton | HBG2:c.364G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 44259 |
1457 | CD 125 GAG>GCG | Hb F-Port Royal | HBG2:c.377A>C | Gγ | Causative | γ-chain variant | NG_000007.3 | 44272 |
1458 | CD 130 TGG>GGG | Hb F-Poole | HBG2:c.391T>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 44286 |
2450 | CD 136 GGA>GAA [Gly>Glu] | Hb F-Privas | HBG2:c.410G>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 44305 |
3950 | CD 140 GCC>GAC [Ala>Asp] | Hb F-Wyandotte | HBG2:c.422C>A | Gγ | Causative | γ-chain variant | NG_000007.3 | 44317 |
1459 | CD 146 CAC>TAC | Hb F-Onoda | HBG2:c.439C>T | Gγ | Causative | γ-chain variant | NG_000007.3 | 44334 |
2394 | CD 146 CAC>CGC [His>Arg] | Hb F-Istambul | HBG2:c.440A>G | Gγ | Causative | γ-chain variant | NG_000007.3 | 44335 |
3813 | rs2236794 | N/A | NG_000007.3:g.44579G>A | Gγ | Modifier | Severity | NG_000007.3 | 44579 |
2803 | rs2855125 | N/A | NG_000007.3:g.45159A>C | HBG1-HBG2 | Modifier | Hb F levels, Severity | NG_000007.3 | 45159 |
3105 | rs2255519 | N/A | NG_000007.3:g.45305C>T | Gγ | Modifier | Hb F levels | NG_000007.3 | 45305 |
1524 | Turkish (Aγδβ)0 | N/A | NG_000007.3:g.45410_81665del36256 | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 45410 |
1504 | SE Asian, Thai (Aγδβ)0 (HPFH-6) | N/A | NC_000011.10:g.5172745_5252029 | Aγ, δ, β, pseudo β, OR51V1, OR52Z1-OR51V1 | Causative | δβ-thalassaemia, Hb F levels | NG_000007.3 | 45587 |
2802 | rs2855126 | N/A | NG_000007.3:g.45699G>C | HBG1-HBG2 | Modifier | Hb F levels, Hyperuricemia, Severity | NG_000007.3 | 45699 |
1520 | German (Aγδβ)0 | N/A | NC_000011.10:g.(5197976_ 5198976)_(5251297_5251694)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 45922 |
3812 | rs2855036 | N/A | NG_000007.3:g.46164G>A | Aγ | Modifier | Severity | NG_000007.3 | 46164 |
2801 | rs2855038 | N/A | NG_000007.3:g.46692A>G | Aγ | Modifier | Hb F levels, Severity | NG_000007.3 | 46692 |
3104 | rs2855039 | N/A | NG_000007.3:g.47175G>A | Aγ | Modifier | Hb F levels | NG_000007.3 | 47175 |
1523 | Malaysian-2 (Aγδβ)0 | N/A | NC_000011.10:g.(5207467_5208467)_(5250061_5250240)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 47376 |
3920 | -368 C>A | N/A | HBG1:c.-420C>A | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47391 |
3887 | -365 G>C | N/A | HBG1:c.-417G>C | Aγ | Neutral | N/A | NG_000007.3 | 47394 |
4074 | -352 A>G | N/A | HBG1:c.-404A>G | Aγ | Neutral | N/A | NG_000007.3 | 47407 |
3865 | -219 (+AGCA) | N/A | HBG1:c.-272_-275dup | Aγ | Causative | HPFH | NG_000007.3 | 47537 |
1565 | -211 C>T (Venezuelan non-deletional HPFH) | N/A | HBG1:c.-264C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47548 |
1566 | -202 C>T (Black non-deletional HPFH) | N/A | HBG1:c.-255C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47557 |
1567 | -201 C>T (Greek non-deletional HPFH) | N/A | HBG1:c.-254C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47558 |
1568 | -198 T>C (British non-deletional HPFH) | N/A | HBG1:c.-251T>C | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47561 |
2301 | -197 C>T | N/A | HBG1:c.-250C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47562 |
1569 | -196 C>T (Italian/Chinese non-deletional HPFH) | N/A | HBG1:c.-249C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47563 |
1570 | -195 C>G (Brazilian non-deletional HPFH) | N/A | HBG1:c.-248C>G | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47564 |
1571 | -175 T>C (Black non-deletional HPFH) | N/A | HBG1:c.-228T>C | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47584 |
1572 | -158 C>T (Cretan non-deletional HPFH) | N/A | HBG1:c.-211C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47601 |
1573 | -117 G>A (Greek/Italian/Black non-deletional HPFH) | N/A | HBG1:c.-170G>A | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47642 |
1574 | -114 to -102 (13 bp deletion , Black non-deletional HPFH) | N/A | HBG1:c.-167_-155delCAATAGCCTTGAC | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47645 |
1575 | -114 C>T (Georgian non-deletional HPFH) | N/A | HBG1:c.-167C>T | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47645 |
3025 | -114 C>G (African-American/Hispanic non-deletional HPFH) | N/A | HBG1:c.-167C>G | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47645 |
2302 | -113 A>G | N/A | HBG1:c.-166A>G | Aγ | Causative | HPFH, Hb F levels | NG_000007.3 | 47646 |
2945 | rs368698783 (Aγ(+25 G>A)) | N/A | NG_000007.3:g.47783G>A | Aγ | Modifier | Hb F levels | NG_000007.3 | 47783 |
1460 | CD 2 CAT>CAG | Hb F-Macedonia-I | HBG1:c.9T>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 47820 |
1461 | CD 5 GAG>AAG | Hb F-Texas-I | HBG1:c.16G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 47827 |
1408 | CD 6 GAG>AAG | Hb F-Texas-II | HBG1:c.19G>A | HBG2:c.19G>A | Aγ or Gγ | Causative | γ-chain variant | NG_000007.3 | 47830 |
1462 | CD 6 GAG>CAG | Hb F-Pordenone | HBG1:c.19G>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 47830 |
1463 | CD 6 GAG>GGG | Hb F-Kotobuki | HBG1:c.20A>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 47831 |
1411 | CD 12 ACA>AAA [Thr>Lys] | Hb F-Alexandra | HBG1:c.38C>A | HBG2:c.38C>A | Aγ or Gγ | Causative | γ-chain variant | NG_000007.3 | 47849 |
1464 | CD 12 ACA>AGA | Hb F-Calluna | HBG1:c.38C>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 47849 |
3320 | CD 16 GGC>GAC [Gly>Asp] | Hb F-Chori-I | HBG1:c.50G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 47861 |
1465 | CD 22 GAT>AAT [Asp>Asn] | Hb F-Beni Khirane | HBG1:c.67G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 47878 |
1466 | CD 22 GAT>GGT | Hb F-Kuala Lumpur | HBG1:c.68A>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 47879 |
1467 | CD 23 (-GCT) | Hb F-Mauritius | HBG1:c.70_72del | Aγ | Causative | γ-chain variant | NG_000007.3 | 47881 |
1468 | CD 25 GGA>CGA | Hb F-Xinjiang | HBG1:c.76G>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 47887 |
3321 | CD 29 GGA>GAA [Gly>Glu] | Hb F-Chori-II | HBG1:c.89G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 47900 |
1469 | CD 36 CCA>CGA | Hb F-Pendergrass | HBG1:c.110C>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 48043 |
1470 | CD 37 TGG>GGG | Hb F-Cobb | HBG1:c.112T>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 48045 |
1471 | CD 39 CAG>CGG | Hb F-Bonaire-GA | HBG1:c.119A>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 48052 |
1472 | CD 40 AGG>AAG | Hb F-Woodstock | HBG1:c.122G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48055 |
1473 | CD 43 GAC>AAC | Hb F-Fukuyama | HBG1:c.130G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48063 |
1474 | CD 53 GCC>GAC | Hb F-Beech Island | HBG1:c.161C>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48094 |
1530 | Italian (Aγδβ)0 | N/A | NC_000011.10:g.5194458_5249516del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 48100 |
1475 | CD 61 AAG>GAG | Hb F-Jamaica | HBG1:c.184A>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 48117 |
3917 | CD 67 GTG>ATG [Val>Met] | Hb Toms River | HBG1:c.202G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48135 |
1476 | CD 72 GGA>CGA | Hb F-Iwata | HBG1:c.217G>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 48150 |
1477 | CD 73 GAT>CAT | Hb F-Xin-Su | HBG1:c.220G>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 48153 |
1478 | CD 73 GAT>AAT | Hb F-Forest Park | HBG1:c.220G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48153 |
1479 | CD 75 ATA>ACA | Hb F-Sardinia (AgammaT) | HBG1:c.227T>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 48160 |
1480 | CD 79 GAT>AAT | Hb F-Dammam | HBG1:c.238G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48171 |
1481 | CD 80 GAT>AAT | Hb F-Yamaguchi | HBG1:c.241G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 48174 |
1482 | CD 80 GAT>TAT [Asp>Tyr] | Hb F-Victoria Jubilee | HBG1:c.241G>T | Aγ | Causative | γ-chain variant | NG_000007.3 | 48174 |
1498 | (HPFH-7, Kenya) | Hb Kenya | NG_000007.3:g.48194_70985del | Aγ, δ, β, pseudo β | Causative | β-chain variant, Hb F levels | NG_000007.3 | 48194 |
2415 | CD 91 CTG>CGG [Leu>Arg] | Hb F-Moyen-Orient | HBG1:c.275T>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 48208 |
1483 | CD 97 CAT>CGT | Hb F-Dickinson | HBG1:c.293A>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 48226 |
3158 | rs11036455 | N/A | NG_000007.3:g.48428T>C | Aγ | Modifier | Hb F levels | NG_000007.3 | 48428 |
1527 | Chinese (Aγδβ)0 | N/A | NC_000011.10:g.5169918_5248821del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 48795 |
3814 | rs2187608 | N/A | NG_000007.3:g.48915C>G | Aγ | Modifier | Severity | NG_000007.3 | 48915 |
1526 | Black (Aγδβ)0 | N/A | NC_000011.10:g.5212727_5248576del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 49040 |
3574 | rs28440105 | N/A | NG_000007.3:g.49047T>G | NG_000007.3:g.49047T>A | Aγ | Neutral | N/A | NG_000007.3 | 49047 |
2556 | CD 113 GTT>ATT [Val>Ile] | Hb F-Sykesville MD | HBG1:c.340G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 49153 |
1484 | CD 119 GGC>AGC [Gly>Ser] | Hb F-Osilo | HBG1:c.358G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 49171 |
1485 | CD 121 GAA>AAA [Glu>Lys] (Hb F-Siena) | Hb F-Hull | HBG1:c.364G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 49177 |
1487 | CD 121 GAA>CAA | Hb F-Campinas | HBG1:c.364G>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 49177 |
2396 | CD 121 GAA>GTA [Glu>Val] | Hb F-Salamanque | HBG1:c.365A>T | Aγ | Causative | γ-chain variant | NG_000007.3 | 49178 |
2453 | CD 125 GAG>GCG [Glu>Ala] | Hb F-Port Royal II | HBG1:c.377A>C | Aγ | Causative | γ-chain variant | NG_000007.3 | 49190 |
1488 | CD 128 GCT>ACT | Hb F-Baskent | HBG1:c.385G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 49198 |
1489 | CD 131 CAG>CAT [Gln>His] | Hb F-Oman | HBG1:c.396G>T | Aγ | Causative | γ-chain variant | NG_000007.3 | 49209 |
1490 | CD 134 GTG>ATG | Hb F-Jiangsu | HBG1:c.403G>A | Aγ | Causative | γ-chain variant | NG_000007.3 | 49216 |
1491 | CD 136 GCA>TCA | Hb F-Porto Torres | HBG1:c.409G>T | Aγ | Causative | γ-chain variant | NG_000007.3 | 49222 |
1492 | CD 136 GCA>GGA | Hb F-Charlotte | HBG1:c.410C>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 49223 |
3892 | CD 139 AGT>AGG [Ser>Arg] | Hb F-Streeterville | HBG1:c.420T>G | Aγ | Causative | γ-chain variant | NG_000007.3 | 49233 |
3159 | rs201642811 | N/A | NG_000007.3:g.49274T>G | Aγ | Modifier | Hb F levels | NG_000007.3 | 49274 |
2800 | rs916111 | N/A | NG_000007.3:g.49503A>T | Aγ | Modifier | Hb F levels, Severity | NG_000007.3 | 49503 |
3103 | rs10488676 | N/A | NG_000007.3:g.50049C>T | Aγ | Modifier | Hb F levels | NG_000007.3 | 50049 |
1506 | Indian (δβ)0 (32.6 kb GγΑγ(δβ)0 Indian del) | N/A | NC_000011.10:g.5214461_5247124del | δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 50492 |
1508 | Japanese (δβ)0 | N/A | NC_000011.10:g.5132468_5246133del | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 51483 |
3845 | rs7924684 | N/A | NG_000007.3:g.52118G>A | BGLT3 | Modifier | Hb F levels | NG_000007.3 | 52118 |
3811 | rs11036431 | N/A | NG_000007.3:g.53166C>T | pseudo β | Modifier | Severity | NG_000007.3 | 53166 |
1501 | Indian HPFH-3 | N/A | NC_000011.10:g.5194459_5244226del | δ, β, pseudo β | Causative | HPFH, Hb F levels | NG_000007.3 | 53390 |
2815 | rs2071348 | N/A | NG_000007.3:g.54700A>C | pseudo β | Modifier | Hb F levels, Severity | NG_000007.3 | 54700 |
1500 | Ghanaian (HPFH-2) | N/A | NC_000011.10:g.5158438_5242749del | δ, β, pseudo β | Causative | HPFH, Hb F levels | NG_000007.3 | 54867 |
2827 | rs16912210 | N/A | NG_000007.3:g.54993T>C | pseudo β | Modifier | Hb F levels | NG_000007.3 | 54993 |
2128 | rs10128556 | N/A | NG_000007.3:g.55163G>A | pseudo β | Modifier | HPFH, Hb F levels, Severity | NG_000007.3 | 55163 |
2156 | Algerian HPFH deletion | N/A | NG_000007.3:g.57141_81002del; 81008delA | δ, β | Causative | HPFH, Hb F levels | NG_000007.3 | 57141, 81008 |
2155 | French West-Indies deletion/insertion (French West-Indies HPFH deletion) | N/A | NG_000007.3:g.57155_80887delinsCAGCAGGAAAGTGAGAAG | δ, β | Causative | HPFH, Hb F levels | NG_000007.3 | 57155 |
110 | IVS I-5 (G>A) + Corfu deletion (7.2 kb Corfu δβ thalassaemia, Corfu (δβ)0) | N/A | NG_000007.3:g.57237_64443del7207; HBB:c.92+5G>A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 57237, 70691 |
1497 | Corfu (δ)0 (7.2kb Corfu deletion) | N/A | NG_000007.3:g.57237_64443del7207 | δ | Causative | δ-thalassaemia | NG_000007.3 | 57237 |
3971 | Tunisian (δβ)0 | N/A | NG_000007.3:g.58253_72837del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 58253 |
2870 | rs968856 | N/A | NG_000007.3:g.58270A>G | HBD-HBBP1 | Modifier | Hb F levels | NG_000007.3 | 58270 |
3575 | rs968857 | N/A | NG_000007.3:g.58388A>T | NG_000007.3:g.58388A>G | HBD-HBBP1 | Neutral | N/A | NG_000007.3 | 58388 |
2811 | rs2105819 | N/A | NG_000007.3:g.59119C>G | HBD-HBBP1 | Modifier | Hb F levels, Severity | NG_000007.3 | 59119 |
1499 | Black (HPFH-1) | N/A | NC_000011.10:g.5153222_5238138delinsAAATA | δ, β | Causative | HPFH, Hb F levels | NG_000007.3 | 59478 |
2828 | rs4910736 | N/A | NG_000007.3:g.59857G>T | HBD-HBBP1 | Modifier | Hb F levels | NG_000007.3 | 59857 |
2810 | rs4910543 | N/A | NG_000007.3:g.60019C>G | HBD-HBBP1 | Modifier | Hb F levels, Severity | NG_000007.3 | 60019 |
2809 | rs4402323 | N/A | NG_000007.3:g.60254G>A | HBD-HBBP1 | Modifier | Hb F levels, Severity | NG_000007.3 | 60254 |
2871 | rs4283007 | N/A | NG_000007.3:g.60356T>A | HBD-HBBP1 | Modifier | Hb F levels | NG_000007.3 | 60356 |
1509 | Spanish (δβ)0 | N/A | NG_000011.10:g.5144331_5237241del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 60375 |
1510 | Black (δβ)0 | N/A | NG_000007.3:g.(60530_60730)_(72351_72551)del11822 | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 60530 |
2808 | rs4320977 | N/A | NG_000007.3:g.60684T>C | HBD-HBBP1 | Modifier | Hb F levels, Severity | NG_000007.3 | 60684 |
2807 | rs10837643 | N/A | NG_000007.3:g.60808A>T | HBD-HBBP1 | Modifier | Hb F levels, Severity | NG_000007.3 | 60808 |
2806 | rs3759074 | N/A | NG_000007.3:g.61068C>T | δ | Modifier | Hb F levels, Severity | NG_000007.3 | 61068 |
2154 | French deletion/insertion (French HPFH deletion) | N/A | NG_000007.3:g.[61399_61400insC; 61402_81144del] | δ, β | Causative | HPFH, Hb F levels | NG_000007.3 | 61402 |
2799 | rs3813727 | N/A | NG_000007.3:g.62934T>C | δ | Modifier | Hb F levels, Severity | NG_000007.3 | 62934 |
3601 | -130 A>G | N/A | HBD:c.-180A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63003 |
3223 | CAP +48 (A>T) | N/A | HBD:c.-6A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63019 |
2202 | CAP +53 (G>A) | N/A | HBD:c.-1G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63024 |
1321 | -80 (G>A) | N/A | HBD:c.-130G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63053 |
1322 | -77 T>C | N/A | HBD:c.-127T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63056 |
1323 | -76 (A>T) | N/A | HBD:c.-126A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63057 |
1324 | -68 (C>T) | N/A | HBD:c.-118C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63065 |
1325 | -65 (A>G) | N/A | HBD:c.-115A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63068 |
1326 | -55 (T>C) | N/A | HBD:c.-105T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63078 |
3602 | -44 G>A | N/A | HBD:c.-94G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63089 |
1327 | -36 (C>A) | N/A | HBD:c.-86C>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63097 |
4096 | Hb Anti-Lepore Laibin | Hb Anti-Lepore Laibin | NG_000007.3:g.63100_70511dup | δ, β | Causative | δ-chain variant | NG_000007.3 | 63100 |
1328 | -31 (A>G) | N/A | HBD:c.-81A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63102 |
1329 | -30 T>C | N/A | HBD:c.-80T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63103 |
3792 | N/A | Hb Lepore-Hong Kong | NG_000007.3:g.63154_70565del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 63154 |
3964 | Hb Anti-Lepore Liuzhou | N/A | NG_000007.3:g.63154_70565dup | δ, β | Causative | δ-chain variant | NG_000007.3 | 63154 |
1330 | Init CD ATG>ATA [Met>Ile] | N/A | HBD:c.3G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63185 |
1347 | CD 1 GTG>GCG | Hb A2-Niigata | HBD:c.5T>C | δ | Causative | δ-chain variant | NG_000007.3 | 63187 |
2328 | CD 2 CAT>AAT [His>Asn] | Hb A2-Calderdale | HBD:c.7C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63189 |
1348 | CD 2 CAT>CTT | Hb A2-Catania | HBD:c.8A>T | δ | Causative | δ-chain variant | NG_000007.3 | 63190 |
1349 | CD 2 CAT>CGT | Hb A2-Sphakiá | HBD:c.8A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63190 |
3307 | N/A | Hb Lepore Rochester-MN | NG_000007.3:g.[63191_70603dup;63291_70703del] | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63191 |
3366 | CD 3 CTG>CCG [Leu>Pro] | Hb A2-Sile | HBD:c.11T>C | δ | Causative | δ-chain variant | NG_000007.3 | 63193 |
1331 | CD 4 ACT>ATT [Thr>Ile] (HbA2-Mitsero) | N/A | HBD:c.14C>T | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63196 |
1350 | CD 4 ACT>AGT [Thr>Ser] | Hb A2-Acacias | HBD:c.14C>G | δ | Causative | δ-chain variant | NG_000007.3 | 63196 |
3617 | CD 5 CCT>ACT [Pro>Thr] | Hb A2-Partinico | HBD:c.16C>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63198 |
3231 | CD 7 (-3bp): (-GAG) | N/A | HBD:c.22_24delGAG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
3336 | CD 7 GAG>TAG [Glu>STOP] | N/A | HBD:c.22G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
4035 | CD 7 GAG>AAG [Glu>Lys] | Hb A2-Zhengzhou | HBD:c.22G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63204 |
1351 | CD 7 GAG>GCG [Glu>Ala] | Hb A2-Udine | HBD:c.23A>C | δ | Causative | δ-chain variant | NG_000007.3 | 63205 |
2325 | CD 7 GAG>GAC [Glu>Asp] | Hb A2-Pordenone | HBD:c.24G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63206 |
1352 | CD 8 AAG>GAG [Lys>Glu] | Hb A2-Toranomon | HBD:c.25A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63207 |
4030 | CD 8 AAG>AAC [Lys>Asn] | Hb A2-Hengyang | HBD:c.27G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63209 |
3232 | CD 10 GCT>-CT | N/A | HBD:c.31delG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63213 |
3243 | CD 10 GCT>CCT [Ala>Pro] | Hb A2-Guangzhou | HBD:c.31G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63213 |
3496 | CD 10 GCT>GTT [Ala>Val] | Hb A2-Canakkale | HBD:c.32C>T | δ | Causative | δ-chain variant | NG_000007.3 | 63214 |
1353 | CD 11 GTC>GGC | Hb A2-Pylos | HBD:c.35T>G | δ | Causative | δ-chain variant | NG_000007.3 | 63217 |
2299 | CD 12 AAT>ACT (Asn>Thr) | Hb A2-Rotterdam | HBD:c.38A>C | δ | Causative | δ-chain variant | NG_000007.3 | 63220 |
1354 | CD 12 AAT>AAA [Asn>Lys] | Hb A2-NYU | HBD:c.39T>A | δ | Causative | δ-chain variant | NG_000007.3 | 63221 |
1355 | CD 13 GCC>GAC [Ala>Asp] (Hb A2-Corleone) | Hb A2-MUMC | HBD:c.41C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63223 |
2448 | CD 14 CTG>CCG [Leu>Pro] | Hb A2-Saint-Etienne | HBD:c.44T>C | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63226 |
3628 | CD 15 TGG>CGG [Trp>Arg] | Hb A2-Utah | HBD:c.46T>C | δ | Causative | δ-chain variant | NG_000007.3 | 63228 |
3372 | CD 15 TGG>TTG [Trp>Leu] | Hb A2-Stockholm | HBD:c.47G>T | δ | Causative | δ-chain variant | NG_000007.3 | 63229 |
1356 | CD 16 GGC>CGC | Hb A2' or Hb B2 | HBD:c.49G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63231 |
4097 | CD 17 AAA>CAA [Lys>Gln] | Hb A2-Laibin | HBD:c.52A>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63234 |
3242 | CD 17 AAA>ACA [Lys>Thr] | Hb A2-Qingyuan | HBD:c.53A>C | δ | Causative | δ-chain variant | NG_000007.3 | 63235 |
4039 | CD 18 GTG>GGG [Val>Gly] | Hb A2-Siping | HBD:c.56T>G | δ | Causative | δ-chain variant | NG_000007.3 | 63238 |
2292 | CD 19 AAC>AAA [Asn>Lys] | Hb Famagusta | HBD:c.60C>A | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63242 |
1357 | CD 20 GTG>GAG | Hb A2-Roosevelt | HBD:c.62T>A | δ | Causative | δ-chain variant | NG_000007.3 | 63244 |
3241 | CD 21 GAT>GGT [Asp>Gly] | Hb A2-Dongguan | HBD:c.65A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63247 |
2447 | CD 22 GCA>ACA>AAA [Ala>Lys] | Hb A2-Marseille | HBD:c.[67G>A; 68C>A] | δ | Causative | δ-chain variant | NG_000007.3 | 63249 |
1396 | (δβδ hybrid) | Hb Parchman | NG_000007.3:g.[63249_70661del;63571_70985dup] | δ, β | Causative | δ-chain variant | NG_000007.3 | 63249 |
1401 | (Hb Anti-Lepore Miyada) | Hb Miyada | NG_000007.3:g.63249_70661dup | δ, β | Causative | N/A | NG_000007.3 | 63249 |
1358 | CD 22 GCA>GAA [Ala>Glu] | Hb A2-Flatbush | HBD:c.68C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63250 |
1359 | CD 24 GGT>GAT | Hb A2-Victoria | HBD:c.74G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63256 |
1360 | CD 25 GGT>GAT | Hb A2-Yokoshima | HBD:c.77G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63259 |
1361 | CD 26 GAG>GAC | Hb A2-Puglia | HBD:c.81G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63263 |
1332 | CD 27 GCC>TCC [Ala>Ser] | Hb A2-Yialousa | HBD:c.82G>T | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63264 |
3187 | rs35152987 | N/A | NG_000007.3:g.63264G>T | δ | Modifier | Anaemia | NG_000007.3 | 63264 |
3240 | CD 28 CTG>CCG [Leu>Pro] | Hb A2-Hunan | HBD:c.86T>C | δ | Causative | δ-chain variant | NG_000007.3 | 63268 |
2437 | CD 29 GGC>GAC [Gly>Asp] | Hb A2-Hong Kong | HBD:c.89G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63271 |
3960 | CD 29 GGC>GGT [Gly>Gly] | N/A | HBD:c.90C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63272 |
1333 | CD 30 (AGG>ACG) | N/A | HBD:c.92G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63274 |
3883 | IVS I-1 G>C | N/A | HBD:c.92+1G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63275 |
1334 | IVS I-2 (T>C) | N/A | HBD:c.92+2T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63276 |
2090 | IVS I-5 G>T | N/A | HBD:c.92+5G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63279 |
1397 | Hb Lepore-Hollandia | NG_000007.3:g.63290_70702del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63290 | |
2563 | IVS I-1 (27 bp insertion) | N/A | HBD:c.92+83_84ins27 | δ | Causative | δ-thalassaemia | NG_000007.3 | 63357 |
3233 | IVS I 3' AG>-C | N/A | HBD:c.93-2delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63401 |
1335 | IVS I-128 G>C (IVS I 3' AG>AC) | N/A | HBD:c.93-1G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63402 |
1363 | CD 36 CCT>CAT | Hb A2-Metaponto | HBD:c.110C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63420 |
3387 | CD 36 CCT>CGT [Pro>Arg] | Hb A2-Sanremo | HBD:c.110C>G | δ | Causative | δ-chain variant | NG_000007.3 | 63420 |
1336 | CD 37 (TGG>TAG) | N/A | HBD:c.113G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63423 |
4029 | CD 39 CAG>AAG [Gln>Lys] | Hb A2-Chengdu | HBD:c.118C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63428 |
2320 | CD 39 CAG>CAC [Gln>His] | Hb A2-Lyon | HBD:c.120G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63430 |
4037 | CD 40 AGG>AGT [Arg>Ser] | Hb A2-Wuhan | HBD:c.123G>T | δ | Causative | δ-chain variant | NG_000007.3 | 63433 |
3239 | CD 42 TTT>CTT [Phe>Leu] | Hb A2-Huadu | HBD:c.127T>C | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63437 |
1364 | CD 43 GAG>AAG | Hb A2-Melbourne | HBD:c.130G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63440 |
1365 | CD 43 GAG>GGG | Hb A2-Agrinio | HBD:c.131A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63441 |
3238 | CD 44 TCC>TGC [Ser>Cys] | Hb A2-Conghua | HBD:c.134C>G | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63444 |
3806 | CD 44-48 (-CTTTGGGGATC) (p.Phe46Valfs*4) | N/A | HBD:c.135_145del | δ | Causative | δ-thalassaemia | NG_000007.3 | 63445 |
4026 | CD 46 GGG>CGG [Gly>Arg], IVS II-456 A>G | Hb A2-Malay | HBD:c.[139G>C;316-443A>G] | δ | Causative | δ-thalassaemia | NG_000007.3 | 63449, 64081 |
4069 | CD 46 GGG>AGG [Gly>Arg] | Hb A2-Yulin | HBD:c.139G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63449 |
2425 | CD 46 GGG>GAG [Gly>Glu] | Hb A2-Tunis | HBD:c.140G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63450 |
3317 | CD 47 GAT>AAT [Asp>Asn] | Hb A2-Lampang | HBD:c.142G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63452 |
1366 | CD 47 GAT>GTT | Hb A2-Parkville | HBD:c.143A>T | δ | Causative | δ-chain variant | NG_000007.3 | 63453 |
2426 | CD 50 TCT>ACT [Ser>Thr] | Hb A2-Konz | HBD:c.151T>A | δ | Causative | δ-chain variant | NG_000007.3 | 63461 |
1367 | CD 51 CCT>CGT | Hb A2-Adria | HBD:c.155C>G | δ | Causative | δ-chain variant | NG_000007.3 | 63465 |
2329 | CD 52 GAT>CAT [Asp>His] | Hb A2-Walsgrave | HBD:c.157G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63467 |
3316 | CD 53 GCT>CCT [Ala>Pro] | Hb A2-Edirne | HBD:c.160G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63470 |
3315 | CD 56 GGC>GAC [Gly>Asp] | Hb A2-Shah Alam | HBD:c.170G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63480 |
1368 | CD 57 AAC>AAA | Hb A2-Campania | HBD:c.174C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63484 |
2575 | CD 58 +C | N/A | HBD:c.176_177insC | δ | Causative | δ-thalassaemia | NG_000007.3 | 63486 |
3441 | CD 59 AAG>A-G (δ0 59 (-A)) | N/A | HBD:c.179delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63489 |
1369 | CD 59 AAG>ATG [Lys>Met] | Hb A2-North Africa | HBD:c.179A>T | δ | Causative | δ-chain variant | NG_000007.3 | 63489 |
1370 | CD 59 AAG>AAC | Hb A2-Pasteur-Tunis | HBD:c.180G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63490 |
3237 | CD 59/60 (+GG) | N/A | HBD:c.180_181dup | δ | Causative | δ-thalassaemia | NG_000007.3 | 63490 |
3870 | CD 62 GCT>CCT [Ala>Pro] | N/A | HBD:c.187G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63497 |
1371 | CD 64 GGC>AGC (Gly>Ser) (Hb A2-Venlo) | Hb A2-Fogo | HBD:c.193G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63503 |
4036 | CD 65 AAG>ATG [Lys>Met] | Hb A2-Zhaoqing | HBD:c.197A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63507 |
3495 | CD 65 AAG>AAT [Lys>Asn] | Hb A2-Yunnan | HBD:c.198G>T | δ | Causative | δ-chain variant | NG_000007.3 | 63508 |
4109 | N/A | Hb Lepore-Quanzhou | NG_000007.3:g.63511_70924del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63511 |
2573 | CD 67 GTG>ATG [Val>Met] | Hb A2-Deventer | HBD:c.202G>A | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63512 |
1372 | CD 69 GGT>CGT | Hb A2-Indonesia | HBD:c.208G>C | δ | Causative | δ-chain variant | NG_000007.3 | 63518 |
3406 | CD 69 GGT>GAT [Gly>Asp] | Hb A2-Gebenstorf | HBD:c.209G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63519 |
1373 | CD 70 GCC>GGC [Ala>Gly] (Cubstitution of Ala with Gly at helical position E14, which is in contact with heme.) | Hb A2-Ventimiglia | HBD:c.212C>G | δ | Causative | δ-chain variant | NG_000007.3 | 63522 |
3335 | CD 73 GAT>GTT [Asp>Val] | Hb A2-Henan | HBD:c.221A>T | δ | Causative | δ-chain variant | NG_000007.3 | 63531 |
2324 | CD 74 GGC>GAC [Gly>Asp] | Hb A2-Asti | HBD:c.224G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63534 |
1374 | CD 75 CTG>GTG | Hb A2-Grovetown | HBD:c.226C>G | δ | Causative | δ-chain variant | NG_000007.3 | 63536 |
4092 | CD 76 GCT>GAT [Ala>Asp] | Hb A2-Moyen-Orient | HBD:c.230C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63540 |
3256 | CD 77 CAC>CGC [His>Arg] | Hb A2-Kiriwong | HBD:c.233A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63543 |
4091 | CD 79 GAC>AAC [Asp>Asn] | Hb A2-Guangxi | HBD:c.238G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63548 |
2477 | CD 79 GAC>GGC [Asp>Gly] | Hb A2-Turkish | HBD:c.239A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63549 |
4032 | CD 80 AAC>AAA [Asn>Lys] | Hb A2-Lishui | HBD:c.243C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63552 |
2309 | CD 81 CTC>TTC [Leu>Phe] (Hb A2-Saint-Denis) | Hb A2-St. George's | HBD:c.244C>T | δ | Causative | δ-chain variant | NG_000007.3 | 63554 |
2092 | CD 82 AAG>TAG | N/A | NG_000007.3:g.63557A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63557 |
3992 | CD 82 AAG>AAT [Lys>Asn]; CD133 GTG>ATG [Val>Met] | Hb A2-Roi-Et | HBD:c.[249G>T;400G>A] | δ | Causative | δ-chain variant | NG_000007.3 | 63559, 64608 |
1375 | CD 83 GGC>GAC [Gly>Asp] | Hb A2-Nishishinbashi | HBD:c.251G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63561 |
1398 | Hb Lepore-Baltimore | NG_000007.3:g.63564_70978del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63564 | |
1376 | CD 85 TTT>TCT | Hb A2-Etolia | HBD:c.257T>C | δ | Causative | δ-chain variant | NG_000007.3 | 63567 |
1377 | CD 87 CAG>AAG | Hb A2-Montechiaro | HBD:c.262C>A | δ | Causative | δ-chain variant | NG_000007.3 | 63572 |
3844 | CD 87 CAG>TAG [Gln>STOP] | N/A | HBD:c.262C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63572 |
3236 | CD 87 CAG>C-G | N/A | HBD:c.263delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63573 |
4016 | CD 87 CAG>CGG [Gln>Arg] | Hb A2-Cremona | HBD:c.263A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63573 |
1378 | CD 88 CTG>GTG | Hb A2-Lucania | HBD:c.265C>G | δ | Causative | δ-chain variant | NG_000007.3 | 63575 |
3547 | CD 89 AGT>AAT [Ser>Asn] | Hb A2-Pistoia | HBD:c.269G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63579 |
2476 | CD 90 GAG>AAG [Glu>Lys] | Hb A2-Canebière | HBD:c.271G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63581 |
2354 | CD 90 GAG>GGG [Glu>Gly] | Hb A2-India | HBD:c.272A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63582 |
1379 | CD 90 GAG>GTG [Glu>Val] | Hb A2-Honai | HBD:c.272A>T | δ | Causative | δ-chain variant | NG_000007.3 | 63582 |
1338 | CD 91 (+T) | N/A | HBD:c.275dupT | δ | Causative | δ-thalassaemia | NG_000007.3 | 63585 |
3383 | CD 91 CTG>CCG [Leu>Pro] | Hb A2-Courbevoie | HBD:c.275T>C | δ | Causative | δ-chain variant | NG_000007.3 | 63585 |
1380 | CD 93 TGT>GGT | Hb A2-Sant' Antioco | HBD:c.280T>G | δ | Causative | δ-chain variant | NG_000007.3 | 63590 |
3598 | CD 93/94 (-TG) [Cys>STOP] | N/A | HBD:c.282_283delTG | δ | Causative | N/A | NG_000007.3 | 63592 |
4013 | CD 93 TGT>TGG [Cys>Trp] | Hb A2-Pontedera | HBD:c.282T>G | δ | Causative | δ-chain variant | NG_000007.3 | 63592 |
4031 | CD 96 CTG>CGG [Leu>Arg] | Hb A2-Hubei | HBD:C.290T>G | δ | Causative | δ-chain variant | NG_000007.3 | 63600 |
3222 | CD 97 CAC>CGC [His>Arg] | Hb A2-Merchang | HBD:c.293A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63603 |
3787 | CD 97 CAC>CAT [His>His] | N/A | HBD:c.294C>T | δ | Neutral | N/A | NG_000007.3 | 63604 |
3975 | CD 98 (-GTG, +A) | N/A | HBD:c.295_297delGTGinsA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63605 |
1339 | CD 98 (GTG>ATG) | Hb A2-Wrens | HBD:c.295G>A | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 63605 |
1382 | CD 99 GAT>AAT | Hb A2-Canada | HBD:c.298G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63608 |
4038 | CD 99 GAT>GGT [Asp>Gly] | Hb A2-Wanxian | HBD:c.299A>G | δ | Causative | δ-chain variant | NG_000007.3 | 63609 |
3003 | CD 100 CCT>TCT [Pro>Ser] | Hb A2-Saurashtra | HBD:c.301C>T | δ | Causative | δ-chain variant | NG_000007.3 | 63611 |
3002 | CD 104 AGG>AAG [Arg>Lys] | Hb Chori-Burnaby | HBD:c.314G>A | δ | Causative | δ-chain variant | NG_000007.3 | 63624 |
1383 | CD 104 AGG>AGT | Hb A2-Capri | HBD:c.315G>T | δ | Causative | δ-chain variant | NG_000007.3 | 63625 |
1340 | IVS II-1 G>A | N/A | HBD:c.315+1G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63626 |
1341 | IVS II-6 (T>A) | N/A | HBD:c.315+6T>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63631 |
1399 | Hb Lepore-Boston-Washington | NG_000007.3:g.63632_71046del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63632 | |
1403 | (Hb Anti-Lepore P-India) | Hb P-India | NG_000007.3:g.63632_71046dup | δ, β | Causative | δ-chain variant | NG_000007.3 | 63632 |
1507 | Sicilian (δβ)0 | N/A | NG_000007.3:g.64336_77738del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64336 |
1512 | Laotian (δβ)0 (Thai (δβ)0-thal) | N/A | NG_000007.3:g.(64336_64524)_76866del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 64336 |
1513 | Thai/Vietnamese (δβ)0 (Thai (δβ)0 , Vietnamese (δβ)0 ) | N/A | NG_000007.3:g.64384_76993del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64384 |
1342 | IVS II-894 C>T | N/A | HBD:c.316-5C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64519 |
1343 | IVS II-897 A>C | N/A | HBD:c.316-2A>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 64522 |
2473 | IVS II-897 A>G | N/A | HBD:c.316-2A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 64522 |
2201 | CD 107 G>A [Gly>Asp] | Hb A2-Tianhe | HBD:c.323G>A | δ | Causative | δ-chain variant | NG_000007.3 | 64531 |
3235 | CD 108 AAT>GAT [Asn>Asp] | Hb A2-Meizhou | HBD:c.325A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64533 |
2521 | CD 110-111 +GT | N/A | HBD:c.333_334insGT | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64541 |
3234 | CD 113 (+TG) | N/A | HBD:c.341_342dupTG | δ | Causative | δ-thalassaemia | NG_000007.3 | 64549 |
3230 | CD 115 GCC>GTC [Ala>Val] | N/A | HBD:c.347C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64555 |
3229 | CD 116 CGC>GGC [Arg>Gly] | N/A | HBD:c.349C>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 64557 |
1384 | CD 116 CGC>TGC [Arg>Cys] | Hb A2-Troodos | HBD:c.349C>T | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64557 |
1402 | (Hb Anti-Lepore P-Congo) | Hb P-Congo | NG_000007.3:g.64557_71923dup | δ, β | Causative | δ-chain variant | NG_000007.3 | 64557 |
1385 | CD 116 CGC>CAC [Arg>His] | Hb A2-Coburg | HBD:c.350G>A | δ | Causative | δ-chain variant | NG_000007.3 | 64558 |
3314 | CD 116 CGC>CCC [Arg>Pro] | Hb A2-Bornova | HBD:c.350G>C | δ | Causative | δ-chain variant | NG_000007.3 | 64558 |
3318 | CD 116 CGC>CTC [Arg>Leu] (Hb A2-India) | Hb A2-Lepore | HBD:c.350G>T | δ | Causative | δ-chain variant | NG_000007.3 | 64558 |
1386 | CD 117 AAC>GAC | Hb A2-Liangcheng | HBD:c.352A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64560 |
2574 | CD 117 AAC>ACC [Asn>Thr] | Hb A2-Amsterdam | HBD:c.353A>C | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64561 |
2363 | CD 119 GGC>GAC [Gly>Asp] | Hb A2-Lewisburg | HBD:c.359G>A | δ | Causative | δ-chain variant | NG_000007.3 | 64567 |
3843 | CD 120 AAG>ACG [Lys>Thr] | Hb A2-Liangqing | HBD:c.362A>C | δ | Causative | δ-chain variant | NG_000007.3 | 64570 |
3058 | CD 121 GAA>AAA [Glu>Lys] | Hb A2-Fengshun | HBD:c.364G>A | δ | Causative | δ-chain variant | NG_000007.3 | 64572 |
1387 | CD 121 GAA>GTA | Hb A2-Manzanares | HBD:c.365A>T | δ | Causative | δ-chain variant | NG_000007.3 | 64573 |
4012 | CD 123 ACC>GCC [Thr>Ala] | Hb A2-Kuching | HBD:c.370A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64578 |
1388 | CD 125 CAA>GAA | Hb A2-Zagreb | HBD:c.376C>G | δ | Causative | δ-chain variant | NG_000007.3 | 64584 |
3867 | >6.5 Kb deletion | N/A | NG_000007.3:g.(63032_64585)_(71150_72080)del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 64585 |
4034 | CD 125 CAA>CGA [Gln>Arg] | Hb A2-Tongchuan | HBD:c.377A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64585 |
3546 | CD 130 TAT>-AT | Hb A2-Gaslini 1 | HBD:c.391delT | δ | Causative | δ-chain variant | NG_000007.3 | 64599 |
3490 | CD 131 CAG>GAG [Gln>Glu] | Hb A2-Puer | HBD:c.394C>G | δ | Causative | δ-chain variant | NG_000007.3 | 64602 |
1389 | CD 133 GTG>GCG | Hb A2-Ninive | HBD:c.401T>C | δ | Causative | δ-chain variant | NG_000007.3 | 64609 |
3842 | CD134 GTG>GAG [Val>Glu] | N/A | HBD:c.404T>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 64612 |
1390 | CD 136 GGT>GAT [Gly>Asp] | Hb A2-Babinga | HBD:c.410G>A | δ | Causative | δ-chain variant | NG_000007.3 | 64618 |
2482 | CD 137 -GTG [-Val] (Hb Anti-Lepore Lincoln Park) | Hb Lincoln Park | HBD:c.412_414delGTG | δ | Causative | δ-chain variant, Haemolytic anaemia | NG_000007.3 | 64620 |
1391 | CD 140 GCC>GTC | Hb A2-Bagheria | HBD:c.422C>T | δ | Causative | δ-chain variant | NG_000007.3 | 64630 |
1392 | CD 141 CTG>CCG | Hb A2-Pelendri | HBD:c.425T>C | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64633 |
2524 | CD 142 GCT>CCT [Ala>Pro] | N/A | HBD:c.427C>A | δ | Causative | δ-chain variant | NG_000007.3 | 64635 |
2560 | CD 142 GCT>GTT [Ala>Val] | Hb A2-Episkopi | HBD:c.428C>T | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64636 |
1393 | CD 142 GCT>GAT [Ala>Asp] | Hb A2-Fitzroy | HBD:c.428C>A | δ | Causative | δ-chain variant | NG_000007.3 | 64636 |
2392 | CD 143 CAC>TAC [His>Tyr] | Hb Noah Mehmet Oeztuerk | HBD:c.430C>T | δ | Causative | δ-chain variant | NG_000007.3 | 64638 |
2421 | CD 143 CAC>GAC [His>Asp] | Hb A2-Leuven | HBD:c.430C>G | δ | Causative | δ-chain variant | NG_000007.3 | 64638 |
2989 | CD 143 CAC>CGC [His>Arg] (Hb A2-Abruzzo) | Hb A2-Leuven II | HBD:c.431A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64639 |
3376 | CD 144 AAG>GAG [Lys>Glu] | Hb A2-Angola | HBD:c.433A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64641 |
2349 | CD 144 AAG>ACG [Lys>Thr] | Hb A2-San Floro | HBD:c.434A>C | δ | Causative | δ-chain variant | NG_000007.3 | 64642 |
1394 | CD 146 CAT>CGT | Hb A2-Monreale | HBD:c.440A>G | δ | Causative | δ-chain variant | NG_000007.3 | 64648 |
3269 | CD 147 TGA>CGA [Stop>Arg] | N/A | HBD:c.442T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 64650 |
2520 | CD 147 TGA>TTA | N/A | HBD:c.443G>T | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64651 |
3394 | 223 kb deletion | N/A | NC_000011.10:g.5010012_5232933del | δ, β | Causative | β-thalassaemia | NG_000007.3 | 64683 |
4033 | Poly A +69 (G>T) | N/A | HBD:c.*199G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64851 |
1346 | Poly A +69 (G>A) | N/A | HBD:c.*199G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 64851 |
3958 | 8.2 kb deletion | N/A | NG_000007.3:g.65147_73407del | β | Causative | β-thalassaemia | NG_000007.3 | 65147 |
298 | Filipino (~45 kb deletion) | N/A | NC_000011.10:g.5112882 _5231358del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66258 |
292 | Turk (~7.6 kb deletion) | N/A | NG_000007.3:g.[52524_60162del;66278_73952del] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66278 |
2872 | rs6578588 | N/A | NG_000007.3:g.66595A>G | HBB-HBD | Modifier | Hb F levels, Severity | NG_000007.3 | 66595 |
2283 | South-Italy | N/A | NC_000011.10:g.5164564_5230714del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66902 |
3188 | rs7944544 | N/A | NG_000007.3:g.66997C>A | HBB-HBD | Modifier | Anaemia | NG_000007.3 | 66997 |
2157 | Indian (4056 bp deletion) | N/A | NG_000007.3:g.67357_71413del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 67357 |
3997 | 7.2 kb deletion | N/A | NC_000011.10:g.5222800_5230034del | β | Causative | β-thalassaemia | NG_000007.3 | 67582 |
296 | Dutch (12620 bp deletion) | N/A | NG_000007.3:g.68071_80682del12612 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 68071 |
2124 | Caucasian HPFH (27825 bp deletion) | N/A | NC_000011.10:g.5201455_5229279delins5223936_5223960 | β | Causative | β-thalassaemia, Hb F levels | NG_000007.3 | 68337 |
1505 | South East Asian (SEA) deletion (Vietnamese, SE Asian, HPFH-7, SEA-HPFH, 27 kb deletion) | N/A | NC_000011.10:g.5201647_5229059del | β | Causative | β-thalassaemia, Hb F levels | NG_000007.3 | 68557 |
3189 | rs7936823 | N/A | NG_000007.3:g.68678C>T | β | Modifier | Hb F levels, Anaemia, Severity | NG_000007.3 | 68678 |
2869 | rs1003586 | N/A | NG_000007.3:g.69476G>A | β | Modifier | Hb F levels | NG_000007.3 | 69476 |
3823 | 60 kb deletion (Prachinburi β0-thalassemia deletion) | N/A | NC_000011.10:g.5167971_5228123delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 69493 |
289 | Croatian (1605 bp deletion) | N/A | NG_000007.3:g.69561_71164del1604 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69561 |
290 | Thai (3485 bp deletion, Chongqing deletion, NC_000011.10: g.5224303-5227790del, NC_000011.9: g.5245533_5249020del) | N/A | NG_000007.3:g.69826_73313del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69826 |
2150 | 1357 bp deletion (Taiwanese deletion) | N/A | NG_000007.3:g.69997_71353del1357 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69997 |
288 | Black, British (1393 bp deletion) | N/A | NG_000007.3:g.70060_71452del1393 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70060 |
2125 | Afghan (909 bp deletion) | N/A | NG_000007:g.70067_70976del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70067 |
284 | 468 bp deletion | N/A | NG_000007.3:g.70070_70537del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70070 |
2036 | -487 T>C | N/A | NG_000007.3:g.70076C>T | β | Neutral | N/A | NG_000007.3 | 70076 |
285 | Black (532 bp deletion) | N/A | HBB:c.-504_28del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70091 |
3277 | 538 bp deletion | N/A | HBB:c.-464_74del | NG_000007.3:g.70131_70668del | β | Causative | β-thalassaemia | NG_000007.3 | 70131 |
3278 | 1517 bp deletion | N/A | HBB:c.-390_316-169delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 70205 |
2037 | -300 C>T | N/A | NG_000007.3:g.70205C>T | β | Neutral | N/A | NG_000007.3 | 70205 |
4066 | 10.8 kb deletion | N/A | NC_000011.10:g.5216601_5227407del | β | Causative | β-thalassaemia | NG_000007.3 | 70209 |
3081 | -223 T>C | N/A | HBB:c.-273T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70322 |
3562 | -198 A>G | N/A | HBB:c.-248A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70347 |
1 | -190 (G>A) | N/A | HBB:c.-240G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70355 |
2122 | 125 bp deletion | N/A | NG_000007.3:g.70360_70485del125 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70360 |
2153 | Kabylia deletion/insertion | N/A | NG_000007.3:g.70417_72458delinsATAAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70417 |
2546 | -126 C>T | N/A | HBB:c.-176C>T | β | Neutral | N/A | NG_000007.3 | 70419 |
283 | 290 bp deletion | N/A | HBB:c.-176_92+25del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70419 |
2 | -102 (C>A) | N/A | HBB:c.-152C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70443 |
3 | -101 (C>T) | N/A | HBB:c.-151C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
4 | -101 (C>G) | N/A | HBB:c.-151C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
3752 | -99 to -85 (-15bp) | N/A | HBB:c.-149_-135delGTGGAGCCACACCCT | β | Causative | β-thalassaemia | NG_000007.3 | 70446 |
3059 | -98 T>A | N/A | HBB:c.-148T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70447 |
5 | -93 C>G | N/A | HBB:c.-143C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70452 |
6 | -92 (C>T) | N/A | HBB:c.-142C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70453 |
7 | -90 (C>T) | N/A | HBB:c.-140C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
3224 | -90 (C>G) | N/A | HBB:c.-140C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
3990 | -89 to -88 (-AC) | N/A | HBB:c.-139_-138delAC | β | Causative | β-thalassaemia | NG_000007.3 | 70456 |
2178 | -88 C>G | N/A | HBB:c.-138C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
8 | -88 (C>T) | N/A | HBB:c.-138C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
9 | -88 (C>A) | N/A | HBB:c.-138C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
10 | -87 C>G | N/A | HBB:c.-137C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
11 | -87 (C>T) | N/A | HBB:c.-137C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
12 | -87 (C>A) | N/A | HBB:c.-137C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
13 | -86 C>G | N/A | HBB:c.-136C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
14 | -86 (C>A) | N/A | HBB:c.-136C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
4028 | -86 C>T | N/A | HBB:c.-136C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70459 |
3077 | -83 G>A | N/A | HBB:c.-133G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70462 |
3069 | -77 G>C | N/A | HBB:c.-127G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70468 |
3386 | -76 C>A | N/A | HBB:c.-126C>A | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
3671 | -76 C>T | N/A | HBB:c.-126C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
3672 | -73 A>C | N/A | HBB:c.-123A>C | β | Causative | β-thalassaemia | NG_000007.3 | 70472 |
3673 | -73 A>G | N/A | HBB:c.-123A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70472 |
15 | -73 (A>T) | N/A | HBB:c.-123A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70472 |
2997 | -72 T>A | N/A | HBB:c.-122T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70473 |
2171 | -71 C>T | N/A | HBB:c.-121C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70474 |
3674 | -63 A>G | N/A | HBB:c.-113A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70482 |
16 | -56 G>C | N/A | HBB:c.-106G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70489 |
2039 | -54 G>A | N/A | NG_000007.3:g.70491G>A | β | Neutral | N/A | NG_000007.3 | 70491 |
17 | -50 G>A | N/A | HBB:c.-100G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70495 |
3060 | -42 C>G | N/A | HBB:c.-92C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
3925 | -42 (-C) | N/A | HBB:c.-92delC | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
2172 | -41 A>T | N/A | HBB:c.-91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70504 |
18 | -32 (C>A) | N/A | HBB:c.-82C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
19 | -32 (C>T) | N/A | HBB:c.-82C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
20 | -31 (A>G) | N/A | HBB:c.-81A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
21 | -31 (A>C) | N/A | HBB:c.-81A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
22 | -30 (T>A) | N/A | HBB:c.-80T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
23 | -30 (T>C) | N/A | HBB:c.-80T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
2179 | -30 T>G | N/A | HBB:c.-80T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
3062 | -30 (-T) | N/A | HBB:c.-80delT | β | Causative | β-thalassaemia | NG_000007.3 | 70515 |
24 | -29 to -26 (-AA) | N/A | HBB:c.-79_78delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
25 | -29 (A>G) | N/A | HBB:c.-79A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
26 | -29 (A>C) | N/A | HBB:c.-79A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
28 | -28 (A>C) | N/A | HBB:c.-78A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
29 | -28 (A>G) | N/A | HBB:c.-78A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
30 | -27 (A>T) | N/A | HBB:c.-77A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
31 | -27 (-AA) | N/A | HBB:c.-77_-76delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
2175 | -26 A>C | N/A | HBB:c.-76A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70519 |
2565 | -25 G>T | N/A | HBB:c.-75G>T | β | Causative | β-thalassaemia | NG_000007.3 | 70520 |
32 | -25 (G>C) | N/A | HBB:c.-75G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70520 |
282 | 105 bp deletion | N/A | HBB:c.-74_31del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70521 |
3926 | -17 (A>G) | N/A | HBB:c.-67A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70528 |
34 | CAP +1 (A>C) | N/A | HBB:c.-50A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70545 |
3464 | CAP +3 A>T | N/A | HBB:c.-48A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70547 |
35 | CAP +8 (C>T) | N/A | HBB:c.-43C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70552 |
36 | CAP +10 (-T) (5'UTR +10 (-T)) | N/A | HBB:c.-41delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70554 |
2494 | CAP +16 A>G | N/A | HBB:c.-35A>G | β | Neutral | N/A | NG_000007.3 | 70560 |
3627 | CAP +20 (-C) | N/A | HBB:c.-31delC | β | Causative | β-thalassaemia | NG_000007.3 | 70564 |
37 | CAP +20 C>T; IVS II-745 C>G | N/A | HBB:c.[-31C>T;316-106C>G] | β | Neutral | N/A | NG_000007.3 | 70564, 71784 |
38 | CAP +22 (G>A) | N/A | HBB:c.-29G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
3345 | CAP +22 (G>T) | N/A | HBB:c.-29G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
3676 | CAP +27 (C>G) | N/A | HBB:c.-24C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70571 |
33 | -22 to +23 (+45 bp duplication) | N/A | NG_000007.3:g.70573_70617dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70573 |
2536 | CAP +30 T>A | N/A | HBB:c.-21T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70574 |
4089 | CAP +32 (G>C) | N/A | HBB:c.-19G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70576 |
39 | CAP +33 (C>G) | N/A | HBB:c.-18C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70577 |
2176 | CAP +39 C>T | N/A | HBB:c.-12C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70583 |
40 | CAP +41 to +44 (-AACA) (CAP +40 to +43 (-AAAC)) | N/A | HBB:c.-10_-7delAACA | β | Causative | β-thalassaemia | NG_000007.3 | 70585 |
41 | CAP +45 (G>C) | Hb Odisha | HBB:c.-6G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70589 |
42 | Init CD ATG>GTG | N/A | HBB:c.1A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
43 | Init CD ATG>CTG | N/A | HBB:c.1A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
44 | Init CD ATG>ACG | N/A | HBB:c.2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
45 | Init CD ATG>AGG | N/A | HBB:c.2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
46 | Init CD ATG>AAG | N/A | HBB:c.2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
47 | Init CD ATG>ATC | N/A | HBB:c.3G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
48 | Init CD ATG>ATA | N/A | HBB:c.3G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
49 | Init CD ATG>ATT | N/A | HBB:c.3G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
790 | CD 1 GTG>ATG | Hb South Florida | HBB:c.4G>A | β | Causative | β-chain variant | NG_000007.3 | 70598 |
791 | CD 1 GTG>TTG | Hb Niigata | HBB:c.4G>T | β | Causative | β-chain variant | NG_000007.3 | 70598 |
792 | CD 1 GTG>GGG | Hb Watford | HBB:c.5T>G | β | Causative | β-chain variant | NG_000007.3 | 70599 |
793 | CD 1 GTG>GCG | Hb Raleigh | HBB:c.5T>C | β | Causative | β-chain variant | NG_000007.3 | 70599 |
794 | CD 1 GTG>GAG | Hb Doha | HBB:c.5T>A | β | Causative | β-chain variant | NG_000007.3 | 70599 |
51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
795 | CD 2 CAT>TAT | Hb Fukuoka | HBB:c.7C>T | β | Causative | β-chain variant | NG_000007.3 | 70601 |
2542 | CD 2 CAT>AAT [His>Asn] | Hb Franklin Park | HBB:c.7C>A | β | Causative | β-chain variant | NG_000007.3 | 70601 |
3437 | CD 2 CAT>-AT | Hb Bundelkhand | HBB:c.7delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
796 | CD 2 CAT>CCT [His>Pro] (Hb Long Island-Marseille, Hb Agrigente) | Hb Marseille | HBB:c.8A>C | β | Causative | β-chain variant | NG_000007.3 | 70602 |
797 | CD 2 CAT>CTT | Hb Graz | HBB:c.8A>T | β | Causative | β-chain variant | NG_000007.3 | 70602 |
799 | CD 2 CAT>CGT | Hb Deer Lodge | HBB:c.8A>G | β | Causative | β-chain variant | NG_000007.3 | 70602 |
53 | CD 2/3 (+T); CD 5 (-C) | Hb Antalya | HBB:c.[9dupT; 17delC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603, 70611 |
800 | CD 2 CAT>CAA or CAG | Hb Okayama | HBB:c.9T>A | HBB:c.9T>G | β | Causative | β-chain variant | NG_000007.3 | 70603 |
2041 | CD 2 CAC>CAT [His>His] | N/A | NG_000007.3:g.70603T>C | β | Neutral | N/A | NG_000007.3 | 70603 |
3007 | rs713040 (NM_000518.5(HBB):c.9T>C) | N/A | NG_059281.1:g.5059T>C | β | Neutral | N/A | NG_000007.3 | 70603 |
3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
2327 | CD 3 CTG>ATG [Leu>Met] | Hb Niguarda | HBB:c.10C>A | β | Causative | β-chain variant | NG_000007.3 | 70604 |
3794 | CD 3 (CTG>AAG) [Leu>Lys] | Hb Jiangnan | HBB:c.10_11delinsAA | β | Causative | β-chain variant | NG_000007.3 | 70604 |
3850 | CD 3 CTG>TTG [Leu>Leu] | N/A | HBB:c.10C>T | β | Neutral | N/A | NG_000007.3 | 70604 |
802 | CD 3 CTG>GTG [Leu>Val] | Hb Kamakura | HBB:c.10C>G | β | Causative | β-chain variant | NG_000007.3 | 70604 |
52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
803 | CD 3 CTG>CAG [Leu>Gln] | Hb Santo Domingo | HBB:c.11T>A | β | Causative | β-chain variant | NG_000007.3 | 70605 |
2359 | CD 3 CTG>CCG [Leu>Pro] | Hb Jabalpur | HBB:c.11T>C | β | Causative | β-chain variant | NG_000007.3 | 70605 |
3878 | CD 3 CTG>CGG [Leu>Arg] | Hb Sedgwick | HBB:c.11T>G | β | Causative | β-chain variant | NG_000007.3 | 70605 |
2326 | CD 4 ACT>CCT [Thr>Pro] | Hb Benin City | HBB:c.13A>C | β | Causative | β-chain variant | NG_000007.3 | 70607 |
3817 | CD 4 (-T) | N/A | HBB:c.14delC | β | Causative | β-thalassaemia | NG_000007.3 | 70608 |
3949 | CD 4 ACT>ATT [Thr>Ile] | Hb Fox Point | HBB:c.14C>T | β | Causative | β-chain variant | NG_000007.3 | 70608 |
804 | CD 4 ACT>AAT | Hb Wurzburg | HBB:c.14C>A | β | Causative | β-chain variant | NG_000007.3 | 70608 |
55 | CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG) | N/A | HBB:c.[15T>A;16C>T;19G>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70609, 70610, 70613 |
805 | CD 5 CCT>TCT | Hb Tyne | HBB:c.16C>T | β | Causative | β-chain variant | NG_000007.3 | 70610 |
806 | CD 5 CCT>GCT [Pro>Ala] (Hb Hinchingbrooke) | Hb Gorwihl | HBB:c.16C>G | β | Causative | β-chain variant | NG_000007.3 | 70610 |
54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
807 | CD 5 CCT>CGT | Hb Warwickshire | HBB:c.17C>G | β | Causative | β-chain variant | NG_000007.3 | 70611 |
2321 | CD 5 CCT>CTT [Pro>Leu] | Hb Aix-les-Bains | HBB:c.17C>T | β | Causative | β-chain variant | NG_000007.3 | 70611 |
2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
56 | CD 6 (GAG>TAG) | N/A | HBB:c.19G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
808 | CD 6 GAG>AAG; CD 95 AAG>GAG | Hb Arlington Park | HBB:c.[19G>A;286A>G] | β | Causative | β-chain variant | NG_000007.3 | 70613 |
809 | CD 6 GAG>AAG [Glu>Lys] and CD 98 GTG>ATG [Val>Met] | Hb Kingsbury | HBB:c.[19G>A ;295G>A] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70613 |
810 | CD 6 GAG>AAG [Glu>Lys] | HbC | HBB:c.19G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70613 |
811 | CD 6 GAG>AAG [Glu>Lys]; CD 37 TGG>AGG or CGG [Trp>Arg] | Hb C-Rothschild | HBB:c.[19G>A;112T>A] | HBB:c.[19G>A;112T>C] | β | Causative | β-chain variant | NG_000007.3 | 70613, 70836 |
812 | CD 6 GAG>AAG; CD 83 GGC>GAC | Hb C-New Cross | HBB:c.[19G>A;251G>A] | β | Causative | β-chain variant | NG_000007.3 | 70613 |
813 | CD 6 GAG>CAG | Hb Machida | HBB:c.19G>C | β | Causative | β-chain variant | NG_000007.3 | 70613 |
57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
58 | CD 6 (-G) | N/A | HBB:c.20delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
814 | CD 6 GAG>GTG | Hb S-South End | HBB:c.[20A>T;399A>C] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
815 | CD 6 GAG>GTG; CD 23 GTT>ATT | Hb S-Antilles | HBB:c.[20A>T;70G>A] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
816 | CD 6 GAG>GTG; CD 58 CCT>CGT | Hb C-Ziguinchor | HBB:c.[20A>T;176C>G] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
817 | CD 6 GAG>GTG; CD 73 GAT>AAT | Hb C-Harlem | HBB:c.[20A>T;220G>A] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
818 | CD 6 GAG>GTG; CD 82AAG>AAT or AAC | Hb S-Providence | HBB:c.[20A>T;249G>C] | HBB:c.[20A>T;249G>T] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
819 | CD 6 GAG>GTG; CD 142 GCC>GTC | Hb S-Travis | HBB:c.[20A>T;428C>T] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
820 | CD 6 GAG>GTG [Glu>Val]; CD 37 TGG>GGG [Trp>Gly] | Hb C-Ndjamena; Hb S-Northwick | HBB:c.[20A>T;112T>G] | β | Causative | β-chain variant | NG_000007.3 | 70614, 70836 |
821 | CD 6 GAG>GTG; CD 121 GAA>AAA | Hb S-Oman | HBB:c.[20A>T;364G>A] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
822 | CD 6 GAG>GTG [Glu>Val], CD 8 AAG>ACG [Lys>Thr] | Hb S-Clichy | HBB:c.[20A>T;26A>C] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
823 | CD 6 GAG>GTG; CD 90 GAG>AAG | Hb S-Cameroon | HBB:c.[20A>T;271G>A] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
824 | CD 6 GAG>GTG [Glu>Val] (Sickle-cell) | HbS | HBB:c.20A>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70614 |
825 | CD 6 GAG>GTG; CD 68 CTC>TTC | Hb Jamaica Plain | HBB:c.[20A>T;205C>T] | β | Causative | β-chain variant | NG_000007.3 | 70614 |
826 | CD 6 GAG>GCG | Hb G-Makassar | HBB:c.20A>C | β | Causative | β-chain variant | NG_000007.3 | 70614 |
827 | CD 6 GAG>GGG [Glu>Gly] | Hb Lavagna | HBB:c.20A>G | β | Causative | β-chain variant | NG_000007.3 | 70614 |
2440 | CD 6 GAG>GTG [Glu>Val] AND CD 65 AAG>GAG [Lys>Glu] | Hb S-Sao Paulo | HBB:c.[20A>T ;196A>G] | β | Causative | β-chain variant | NG_000007.3 | 70614, 70920 |
3324 | CD 6 GAG>GTG [Glu>Val]; CD 139 AAT>AGT [Asn>Ser] | Hb S-Wake | HBB:c.[20A>T;419A>G] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70614, 71993 |
59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
60 | CD 7 GAG>TAG | N/A | HBB:c.22G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70616 |
828 | CD 7 (-GAG) [-Glu] (Hb Xinyi) | Hb Leiden | HBB:c.22_24delGAG | β | Causative | β-chain variant | NG_000007.3 | 70616 |
829 | CD 7 GAG>AAG | Hb G-Siriraj | HBB:c.22G>A | β | Causative | β-chain variant | NG_000007.3 | 70616 |
2400 | CD 7 GAG>CAG [Glu>Gln] (Hb Bellevue III) | Hb Vellore | HBB:c.22G>C | β | Causative | β-chain variant | NG_000007.3 | 70616 |
2963 | CD 7 GAG>GTG [Glu>Val] | Hb Haaglanden | HBB:c.23A>T | β | Causative | β-chain variant | NG_000007.3 | 70617 |
3288 | CD7 GAG>G-G | N/A | HBB:c.23delA | β | Causative | β-thalassaemia | NG_000007.3 | 70617 |
830 | CD 7 GAG>GGG | Hb G-San José | HBB:c.23A>G | β | Causative | β-chain variant | NG_000007.3 | 70617 |
2382 | CD 7 GAG>GAT [Glu>Asp] | Hb Stockholm | HBB:c.24G>T | β | Causative | β-chain variant | NG_000007.3 | 70618 |
2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
831 | CD 8 AAG>CAG [Lys>Gln] | Hb J-Luhe | HBB:c.25A>C | β | Causative | β-chain variant | NG_000007.3 | 70619 |
832 | CD 8 AAG>GAG | Hb N-Timone | HBB:c.25A>G | β | Causative | β-chain variant | NG_000007.3 | 70619 |
833 | CD 8 AAG>ACG | Hb Rio Grande | HBB:c.26A>C | β | Causative | β-chain variant | NG_000007.3 | 70620 |
834 | CD 8 AAG>ATG | Hb Nakano | HBB:c.26A>T | β | Causative | β-chain variant | NG_000007.3 | 70620 |
835 | CD 8 AAG>AGG [Lys>Arg] | Hb Lucknow | HBB:c.26A>G | β | Causative | β-chain variant | NG_000007.3 | 70620 |
2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
3513 | CD 8 AAG>AA- | N/A | HBB:c.27delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
836 | CD 8 AAG>AAC | Hb Limassol | HBB:c.27G>C | β | Causative | β-chain variant | NG_000007.3 | 70621 |
63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
837 | CD 9 TCT>TAT | Hb Brem-sur-Mer | HBB:c.29C>A | β | Causative | β-chain variant | NG_000007.3 | 70623 |
838 | CD 9 TCT>TGT | Hb Pôrto Alegre | HBB:c.29C>G | β | Causative | β-chain variant | NG_000007.3 | 70623 |
839 | CD 9 TCT>TAT; CD 121 GAA>CAA | Hb D-Agri | HBB:c.[29C>A;364G>C] | β | Causative | β-chain variant | NG_000007.3 | 70623 |
3401 | CD 9 TCT>TTT [Ser>Phe] | Hb Hengyang | HBB:c.29C>T | β | Causative | β-chain variant | NG_000007.3 | 70623 |
3399 | CD 9 TCT>TC- | Hb Antep | HBB:c.30delT | β | Causative | β-chain variant | NG_000007.3 | 70624 |
64 | CD 9/10 (+T) | Hb Gaziantep | HBB:c.30dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70624 |
840 | CD 10 GCC>ACC [Ala>Thr] | Hb Belleville | HBB:c.31G>A | β | Causative | β-chain variant | NG_000007.3 | 70625 |
4108 | CD 10 GCC>GTC [Ala>Val] | N/A | HBB:c.31_32insT | β | Causative | β-thalassaemia | NG_000007.3 | 70625 |
841 | CD 10 GCC>GTC | Hb Iraq-Halabja | HBB:c.32C>T | β | Causative | β-chain variant | NG_000007.3 | 70626 |
842 | CD 10 GCC>GAC | Hb Ankara | HBB:c.32C>A | β | Causative | β-chain variant | NG_000007.3 | 70626 |
65 | CD 10 GCC>GCA [Ala>Ala] | N/A | HBB:c.33C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
843 | CD 11 GTT>ATT | Hb Hamilton | HBB:c.34G>A | β | Causative | β-chain variant | NG_000007.3 | 70628 |
844 | CD 11 GTT>TTT | Hb Washtenaw | HBB:c.34G>T | β | Causative | β-chain variant | NG_000007.3 | 70628 |
845 | CD 11 GTT>ATT; CD 121 GAA>AAA | Hb O-Tibesti | HBB:c.[34G>A;364G>A] | β | Causative | β-chain variant | NG_000007.3 | 70628 |
3297 | CD 11-13 (-9bp): (-GTTACTGCC) | Hb JC-Paz | HBB:c.34_42delGTTACTGCC | β | Causative | β-chain variant | NG_000007.3 | 70628 |
847 | CD 11 GTT>GAT | Hb Windsor | HBB:c.35T>A | β | Causative | β-chain variant | NG_000007.3 | 70629 |
67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
2492 | CD 12 ACT>CCT [Thr>Pro] (Hb Feilding) | Hb Ashburton | HBB:c.37A>C | β | Causative | β-chain variant | NG_000007.3 | 70631 |
2543 | CD 12 ACT>ATT [Thr>Ile] | Hb William-Harvey | HBB:c.38C>T | β | Causative | β-chain variant | NG_000007.3 | 70632 |
3359 | CD 13 GCC>ACC [Ala>Thr] (Hb Chuxiong) | Hb Tower Hamlets | HBB:c.40G>A | β | Causative | β-chain variant | NG_000007.3 | 70634 |
3248 | CD 13 GCC>GTC [Ala>Val] | Hb Yulin | HBB:c.41C>T | β | Causative | β-chain variant | NG_000007.3 | 70635 |
848 | CD 13 GCC>GAC | Hb J-Lens | HBB:c.41C>A | β | Causative | β-chain variant | NG_000007.3 | 70635 |
3721 | CD 14 CTG>-TG | N/A | HBB:c.43delC | β | Causative | β-thalassaemia | NG_000007.3 | 70637 |
2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
849 | CD 14 CTG>CCG | Hb Saki | HBB:c.44T>C | β | Causative | β-chain variant | NG_000007.3 | 70638 |
850 | CD 14 CTG>CGG | Hb Sogn | HBB:c.44T>G | β | Causative | β-chain variant | NG_000007.3 | 70638 |
69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
851 | CD 15 TGG>GGG | Hb Randwick | HBB:c.46T>G | β | Causative | β-chain variant | NG_000007.3 | 70640 |
852 | CD 15 TGG>AGG or CGG | Hb Belfast | HBB:c.46T>A | HBB:c.46T>C | β | Causative | β-chain variant | NG_000007.3 | 70640 |
72 | CD 15 TGG>TAG | N/A | HBB:c.47G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70641 |
73 | CD 15 TGG>TGA | N/A | HBB:c.48G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70642 |
2464 | CD 15 TGG>TGC or TGT [Trp>Cys] | Hb Garston | HBB:c.48G>Y | β | Causative | β-chain variant | NG_000007.3 | 70642 |
2374 | CD 16 GGC>TGC [Gly>Cys] | Hb Whitmire | HBB:c.49G>T | β | Causative | β-chain variant | NG_000007.3 | 70643 |
853 | CD 16 GGC>CGC | Hb D-Bushman | HBB:c.49G>C | β | Causative | β-chain variant | NG_000007.3 | 70643 |
71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
854 | CD 16 GGC>GAC (Hb J-Georgia , Hb J-Ireland , Hb J-Trinidad , Hb N-New Haven) | Hb J-Baltimore | HBB:c.50G>A | β | Causative | β-chain variant | NG_000007.3 | 70644 |
75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
76 | CD 16 GGC>GGT [Gly>Gly] | N/A | HBB:c.51C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
77 | CD 17 AAG>TAG [Lys>STOP] | N/A | HBB:c.52A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70646 |
856 | CD 17 AAG>GAG | Hb Nagasaki | HBB:c.52A>G | β | Causative | β-chain variant | NG_000007.3 | 70646 |
857 | CD 17 AAG>CAG (Hb Nicosia) | Hb Nikosia | HBB:c.52A>C | β | Causative | β-chain variant | NG_000007.3 | 70646 |
78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
2298 | CD 17 AAG>ATG (Lys>Met) | Hb Ede | HBB:c.53A>T | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70647 |
855 | CD 17-19 (-GGTGAA) | Hb Lyon | HBB:c.54_59del | β | Causative | β-chain variant | NG_000007.3 | 70648 |
858 | CD 17 AAG>AAC or AAT | Hb J-Amiens | HBB:c.54G>C | HBB:c.54G>T | β | Causative | β-chain variant | NG_000007.3 | 70648 |
859 | CD 18 GTG>ATG | Hb Baden | HBB:c.55G>A | β | Causative | β-chain variant | NG_000007.3 | 70649 |
3005 | CD 18 GTG>CTG [Val>Leu] | Hb Bhubaneswar | HBB:c.55G>C | β | Causative | β-chain variant | NG_000007.3 | 70649 |
860 | CD 18 GTG>GGG | Hb Sinai-Baltimore | HBB:c.56T>G | β | Causative | β-chain variant | NG_000007.3 | 70650 |
861 | CD 19 AAC>GAC | Hb Alamo | HBB:c.58A>G | β | Causative | β-chain variant | NG_000007.3 | 70652 |
79 | CD 19 AAC>AGC [Asn>Ser] | Hb Malay | HBB:c.59A>G | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70653 |
863 | CD 19 AAC>AAA or AAG | Hb D-Ouled Rabah | HBB:c.60C>A | HBB:c.60C>G | β | Causative | β-chain variant | NG_000007.3 | 70654 |
864 | CD 20 GTG>ATG | Hb Olympia | HBB:c.61G>A | β | Causative | β-chain variant | NG_000007.3 | 70655 |
865 | CD 20 GTG>GGG | Hb Uxbridge | HBB:c.62T>G | β | Causative | β-chain variant | NG_000007.3 | 70656 |
866 | CD 20 GTG>GAG | Hb Trollhättan | HBB:c.62T>A | β | Causative | β-chain variant | NG_000007.3 | 70656 |
2974 | CD 20 GTG>GCG [Val>Ala] | Hb Howden | HBB:c.62T>C | β | Causative | β-chain variant | NG_000007.3 | 70656 |
3609 | CD 20/21 (-TGGA) | N/A | HBB:c.62_65delTGGA | β | Causative | β-thalassaemia | NG_000007.3 | 70656 |
80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
867 | CD 21 GAT>TAT | Hb Yusa | HBB:c.64G>T | β | Causative | β-chain variant | NG_000007.3 | 70658 |
868 | CD 21 GAT>CAT | Hb Karlskoga | HBB:c.64G>C | β | Causative | β-chain variant | NG_000007.3 | 70658 |
869 | CD 21 GAT>AAT | Hb Cocody | HBB:c.64G>A | β | Causative | β-chain variant | NG_000007.3 | 70658 |
870 | CD 21 GAT>GGT | Hb Connecticut | HBB:c.65A>G | β | Causative | β-chain variant | NG_000007.3 | 70659 |
871 | CD 21 GAT>GTT | Hb Rocky Mountain | HBB:c.65A>T | β | Causative | β-chain variant | NG_000007.3 | 70659 |
83 | CD 22 (GAA>TAA) | N/A | HBB:c.67G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70661 |
873 | CD 22 GAA>CAA | Hb D-Iran | HBB:c.67G>C | β | Causative | β-chain variant | NG_000007.3 | 70661 |
874 | CD 22 GAA>AAA | Hb E-Saskatoon | HBB:c.67G>A | β | Causative | β-chain variant | NG_000007.3 | 70661 |
84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
875 | CD 22 GAA>GTA | Hb D-Granada | HBB:c.68A>T | β | Causative | β-chain variant | NG_000007.3 | 70662 |
876 | CD 22 GAA>GCA (Hb G-Hsin Chu, Hb G-Saskatoon, Hb G-Taegu) | Hb G-Coushatta | HBB:c.68A>C | β | Causative | β-chain variant | NG_000007.3 | 70662 |
877 | CD 22 GAA>GGA | Hb G-Taipei | HBB:c.68A>G | β | Causative | β-chain variant | NG_000007.3 | 70662 |
872 | CD 22-26 (-12bp) | Hb Olinda | HBB:c.69_80delAGTTGGTGGTGA | β | Causative | β-chain variant | NG_000007.3 | 70663 |
2330 | CD 22 GAA>GAT [Glu>Asp] | Hb Bury | HBB:c.69A>T | β | Causative | β-chain variant | NG_000007.3 | 70663 |
4106 | CD 23 GTT>TTT; CD 26 GAG>AAG | Hb E-Palmerston North | HBB:c.[70G>T;79G>A] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70664, 70673 |
879 | CD 23 GTT>ATT [Val>Ile] | Hb Saveh | HBB:c.70G>A | β | Causative | β-chain variant | NG_000007.3 | 70664 |
880 | CD 23 GTT>TTT | Hb Palmerston North | HBB:c.70G>T | β | Causative | β-chain variant | NG_000007.3 | 70664 |
878 | CD 23/24 (GTTGGT>GGT) | Hb Freiburg | HBB:c.71_73del | β | Causative | β-chain variant | NG_000007.3 | 70665 |
881 | CD 23 GTT>GCT | Hb Zoeterwoude | HBB:c.71T>C | β | Causative | β-chain variant | NG_000007.3 | 70665 |
882 | CD 23 GTT>GGT | Hb Miyashiro | HBB:c.71T>G | β | Causative | β-chain variant | NG_000007.3 | 70665 |
883 | CD 23 GTT>GAT | Hb Strasbourg | HBB:c.71T>A | β | Causative | β-chain variant | NG_000007.3 | 70665 |
885 | CD 24 GGT>CGT | Hb Riverdale-Bronx | HBB:c.73G>C | β | Causative | β-chain variant | NG_000007.3 | 70667 |
85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
886 | CD 24 GGT>GAT [Gly>Asp] | Hb Moscva | HBB:c.74G>A | β | Causative | β-chain variant | NG_000007.3 | 70668 |
887 | CD 24 GGT>GTT | Hb Savannah | HBB:c.74G>T | β | Causative | β-chain variant | NG_000007.3 | 70668 |
2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
86 | CD 24 GGT>GGA [Gly>Gly] | N/A | HBB:c.75T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70669 |
281 | IVS I [3 end] -44 bp (44 bp deletion) | N/A | HBB:c.76_92+27del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70670 |
888 | CD 25 GGT>CGT | Hb G-Taiwan-Ami | HBB:c.76G>C | β | Causative | β-chain variant | NG_000007.3 | 70670 |
2452 | CD 25 GGT>AGT [Gly>Ser] | Hb Brazzaville | HBB:c.76G>A | β | Causative | β-chain variant | NG_000007.3 | 70670 |
3306 | CD 25/26 -GTG [-Gly] (Hb Higashitochigi, Hb HT) | Hb M Dothan | HBB:c.77_79delGTG | β | Causative | β-chain variant | NG_000007.3 | 70671 |
889 | CD 25 GGT>GAT | Hb J-Auckland | HBB:c.77G>A | β | Causative | β-chain variant | NG_000007.3 | 70671 |
87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
88 | CD 26 GAG>AAG [Glu>Lys] | HbE | HBB:c.79G>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
89 | CD 26 (GAG>TAG) | N/A | HBB:c.79G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
891 | CD 26 GAG>AAG, CD 104 AGG>ACG | Hb Corbeil | HBB:c.[79G>A;314G>C] | β | Causative | β-chain variant | NG_000007.3 | 70673 |
892 | CD 26 GAG>AAG; CD 121 GAA>CAA | Hb T-Cambodia | HBB:c.[79G>A;364G>C] | β | Causative | β-chain variant | NG_000007.3 | 70673 |
3035 | CD 26 GAG>CAG [Glu>Gln] | Hb King's Mill | HBB:c.79G>C | β | Causative | β-chain variant | NG_000007.3 | 70673 |
3409 | CD 26 GAG>AAG, IVS I-7 A>G | Hb E-Udon Thani | HBB:c.[79G>A;92+7A>G] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70673, 70693 |
3597 | CD 26 (GAG>AAG); CD 104 (AGG>GGG) | Hb E-Gurdaspur | HBB:c.[79G>A;313A>G] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70673, 71037 |
4023 | CD 26 GAG>AAG, IVS I-7 A>T | N/A | HBB:c.[79G>A;92+7A>T] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70673, 70693 |
893 | CD 26 GAG>GGG | Hb Aubenas | HBB:c.80A>G | β | Causative | β-chain variant | NG_000007.3 | 70674 |
894 | CD 26 GAG>GCG | Hb Tripoli | HBB:c.80A>C | β | Causative | β-chain variant | NG_000007.3 | 70674 |
895 | CD 26 GAG>GTG [Glu>Val] | Hb Henri Mondor | HBB:c.80A>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70674 |
2403 | CD 26 GAG>GAC or GAT [Glu>Asp] | Hb Marijampolė | HBB:c.81G>Y | β | Causative | β-chain variant | NG_000007.3 | 70675 |
3635 | CD 26 GAG>GAA | N/A | HBB:c.81G>A | β | Neutral | N/A | NG_000007.3 | 70675 |
91 | CD 27 GCC>TCC [Ala>Ser] | Hb Knossos | HBB:c.82G>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70676 |
897 | CD 27 GCC>GTC | Hb Grange-Blanche | HBB:c.83C>T | β | Causative | β-chain variant | NG_000007.3 | 70677 |
898 | CD 27 GCC>GAC | Hb Volga | HBB:c.83C>A | β | Causative | β-chain variant | NG_000007.3 | 70677 |
899 | CD 27 GCC>GGC [Ala>Gly] | Hb Siirt | HBB:c.83C>G | β | Causative | β-chain variant | NG_000007.3 | 70677 |
3781 | CD 27 GCC>GCT [Ala>Ala] | N/A | HBB:c.84C>T | β | Neutral | N/A | NG_000007.3 | 70678 |
92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
900 | CD 28 CTG>ATG [Leu>Met] | Hb Chile | HBB:c.85C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70679 |
94 | CD 28 CTG>CGG [Leu >Arg] | Hb Chesterfield | HBB:c.86T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70680 |
901 | CD 28 CTG>CCG [Leu>Pro] | Hb Genova | HBB:c.86T>C | β | Causative | β-chain variant | NG_000007.3 | 70680 |
902 | CD 28 CTG>CAG [Leu>Gln] | Hb Saint Louis | HBB:c.86T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70680 |
904 | CD 29 GGC>AGC [Gly>Ser] | Hb Tizi-Ouzou | HBB:c.88G>A | β | Causative | β-chain variant | NG_000007.3 | 70682 |
2523 | CD 29 GGC>CGC [Gly>Arg] | Hb Dompierre | HBB:c.88G>C | β | Causative | β-chain variant | NG_000007.3 | 70682 |
95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
905 | CD 29 GGC>GAC | Hb Lufkin | HBB:c.89G>A | β | Causative | β-chain variant | NG_000007.3 | 70683 |
96 | CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly) | N/A | HBB:c.90C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70684 |
2044 | CD 29 GGC>GGG [Gly>Gly] | N/A | NG_000007.3:g.70684C>G | β | Neutral | N/A | NG_000007.3 | 70684 |
97 | CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly) | N/A | HBB:c.91A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
98 | CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg] | N/A | HBB:c.91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
3710 | CD 30 AGG>TGG [Arg>Trp] | Hb New Berlin | HBB:c.91A>T | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70685 |
99 | CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys) | N/A | HBB:c.92G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
100 | CD 30 (G>C) or IVS I (-1) AGG>ACG (Arg>Thr) (Hb Kairouan) | Hb Monroe | HBB:c.92G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
101 | IVS I-1 G>A | N/A | HBB:c.92+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
102 | IVS I-1 (G>T) | N/A | HBB:c.92+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
103 | IVS I-1 (G>C) | N/A | HBB:c.92+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
104 | IVS I-2 (T>G) | N/A | HBB:c.92+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
105 | IVS I-2 (T>C) | N/A | HBB:c.92+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
106 | IVS I-2 (T>A) | N/A | HBB:c.92+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
107 | IVS I-5 (G>C) | N/A | HBB:c.92+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
108 | IVS I-5 (G>T) | N/A | HBB:c.92+5G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
109 | IVS I-5 (G>A) | N/A | HBB:c.92+5G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
111 | IVS I-6 (T>C) | N/A | HBB:c.92+6T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
3565 | IVS I-6 (T>G) | N/A | HBB:c.92+6T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
3276 | IVS I-7 A>G | N/A | HBB:c.92+7A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
112 | IVS I-7 A>T | N/A | HBB:c.92+7A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
3445 | IVS I-13 G>T | N/A | HBB:c.92+13G>T | β | Neutral | N/A | NG_000007.3 | 70699 |
2045 | IVS I-16 A>C | N/A | NG_000007.3:g.70702A>C | β | Neutral | N/A | NG_000007.3 | 70702 |
3246 | IVS I-44 A>G | N/A | HBB:c.92+44A>G | β | Neutral | N/A | NG_000007.3 | 70730 |
3690 | IVS I-65 (G>A) | N/A | HBB:c.92+65G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70751 |
2046 | IVS I-91 C>T | N/A | HBB:c.93-40C>T | β | Neutral | N/A | NG_000007.3 | 70777 |
2047 | IVS I-93 G>A | N/A | NG_000007.3:g.70779G>A | β | Neutral | N/A | NG_000007.3 | 70779 |
3066 | IVS I-108 T>C | N/A | HBB:c.93-23T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70794 |
2173 | IVS I-109 (-T) | N/A | HBB:c.93-22delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
113 | IVS I-110 G>A | N/A | HBB:c.93-21G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70796 |
121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
3008 | IVS I-115 (A>T) | N/A | HBB:c.93-16A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70801 |
114 | IVS I-116 (T>G) | N/A | HBB:c.93-15T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70802 |
124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
115 | IVS I-128 (T>G) | N/A | HBB:c.93-3T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70814 |
116 | IVS I-129 (A>C) | N/A | HBB:c.93-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
117 | IVS I-129 (A>G) | N/A | HBB:c.93-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
4067 | IVS I-129 (A>T) | N/A | HBB:c.93-2A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70815 |
118 | IVS I-130 G>C | N/A | HBB:c.93-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
119 | IVS I-130 (G>A) | N/A | HBB:c.93-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
120 | IVS I-130 (+1) or CD 30, (G>C); AGG>AGC (Arg>Ser) | Hb Tacoma II | HBB:c.93G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70817 |
125 | CD 30/31 +CGG [+Arg] | N/A | HBB:c.93_94insCGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70817 |
907 | CD 30 AGG>AGT [Arg>Ser] | Hb Tacoma | HBB:c.93G>T | β | Causative | β-chain variant | NG_000007.3 | 70817 |
126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
908 | CD 31 CTG>GTG | Hb Badalona | HBB:c.94C>G | β | Causative | β-chain variant | NG_000007.3 | 70818 |
909 | CD 31 CTG>CGG | Hb Hakkari | HBB:c.95T>G | β | Causative | β-chain variant | NG_000007.3 | 70819 |
910 | CD 31 CTG>CCG | Hb Yokohama | HBB:c.95T>C | β | Causative | β-chain variant | NG_000007.3 | 70819 |
911 | CD 32 CTG>GTG | Hb Muscat | HBB:c.97C>G | β | Causative | β-chain variant | NG_000007.3 | 70821 |
127 | CD 32 CTG>CAG: CD 98 GTG>ATG | Hb Medicine Lake | HBB:c.[98T>A; 295G>A] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70822 |
912 | CD 32 CTG>CCG | Hb Perth | HBB:c.98T>C | β | Causative | β-chain variant | NG_000007.3 | 70822 |
913 | CD 32 CTG>CAG [Leu>Gln] | Hb Clermont Ferrand | HBB:c.98T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70822 |
915 | CD 32 CTG>CGG [Leu>Arg] | Hb Castilla | HBB:c.98T>G | β | Causative | β-chain variant | NG_000007.3 | 70822 |
916 | CD 33 GTG>ATG | Hb Rio Claro | HBB:c.100G>A | β | Causative | β-chain variant | NG_000007.3 | 70824 |
3364 | CD 33 GTG>TTG [Val>Leu] | Hb Venissieux | HBB:c.100G>T | β | Causative | β-chain variant | NG_000007.3 | 70824 |
131 | CD 33-35 (-TGGTCT) | Hb Dresden | HBB:c.101_106delTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70825 |
129 | CD 33/34 (GTGGTC>GTC) | Hb Korea | HBB:c.102_104del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
919 | CD 34 GTC>CTC | Hb Nantes | HBB:c.103G>C | β | Causative | β-chain variant | NG_000007.3 | 70827 |
920 | CD 34 GTC>TTC | Hb Pitie-Salpetriere | HBB:c.103G>T | β | Causative | β-chain variant | NG_000007.3 | 70827 |
921 | CD 34 GTC>GAC | Hb Santander | HBB:c.104T>A | β | Causative | β-chain variant | NG_000007.3 | 70828 |
3700 | CD 34 GTC>GCC [Val>Ala] | Hb San Francisco-KP | HBB:c.104T>C | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70828 |
2331 | CD 35 TAC>CAC [Tyr>His] | Hb Fulwood | HBB:c.106T>C | β | Causative | β-chain variant | NG_000007.3 | 70830 |
3795 | CD 35 TAC>GAC [Tyr>Asp] | Hb Oristano | HBB:c.106T>G | β | Causative | β-chain variant | NG_000007.3 | 70830 |
132 | CD 35 TAC>TGC [Tyr>Cys] | N/A | HBB:c.107A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70831 |
922 | CD 35 TAC>TTC [Tyr>Phe] | Hb Philly | HBB:c.107A>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70831 |
133 | CD 35 TAC>TAA | N/A | HBB:c.108C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70832 |
2048 | CD 35 TAC>TAT [Tyr>Tyr] | N/A | NG_000007.3:g.70832C>T | β | Neutral | N/A | NG_000007.3 | 70832 |
3023 | CD 35 TAC>TAG | N/A | HBB:c.108C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
3692 | CD 35 (TAC>TA-) | N/A | HBB:c.108delC | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
923 | CD 36 CCT>ACT | Hb Linköping | HBB:c.109C>A | β | Causative | β-chain variant | NG_000007.3 | 70833 |
924 | CD 36 CCT>GCT | Hb Brie Comte Robert | HBB:c.109C>G | β | Causative | β-chain variant | NG_000007.3 | 70833 |
925 | CD 36 CCT>TCT | Hb North Chicago | HBB:c.109C>T | β | Causative | β-chain variant | NG_000007.3 | 70833 |
128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
926 | CD 36 CCT>CGT [Pro>Arg] | Hb Sunnybrook | HBB:c.110C>G | β | Causative | β-chain variant | NG_000007.3 | 70834 |
927 | CD 36 CCT>CAT | Hb Vila Real | HBB:c.110C>A | β | Causative | β-chain variant | NG_000007.3 | 70834 |
135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
928 | CD 37 TGG>AGG [Trp>Arg] | Hb Rothschild | HBB:c.112T>A | β | Causative | β-chain variant | NG_000007.3 | 70836 |
929 | CD 37 TGG>GGG | Hb Howick | HBB:c.112T>G | β | Causative | β-chain variant | NG_000007.3 | 70836 |
138 | CD 37 (TGG>TAG) | N/A | HBB:c.113G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70837 |
930 | CD 37 TGG>TCG | Hb Hirose | HBB:c.113G>C | β | Causative | β-chain variant | NG_000007.3 | 70837 |
3918 | CD 37 TGG>TTG [Trp>Leu] | Hb Alessandria | HBB:c.113G>T | β | Causative | β-chain variant | NG_000007.3 | 70837 |
3282 | CD 37 TGG>TGC [Trp>Cys] (Hb Kent) | N/A | HBB:c.114G>C | β | Causative | β-chain variant | NG_000007.3 | 70838 |
136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
137 | CD 37 (TGG>TGA) | N/A | HBB:c.114G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
931 | CD 37 TGG>TGT [Trp>Cys] (Hb Greendale) | Hb Kent | HBB:c.114G>T | β | Causative | β-chain variant | NG_000007.3 | 70838 |
932 | CD 38 ACC>CCC | Hb Hazebrouck | HBB:c.115A>C | β | Causative | β-chain variant | NG_000007.3 | 70839 |
933 | CD 38 ACC>AAC | Hb Hinwil | HBB:c.116C>A | β | Causative | β-chain variant | NG_000007.3 | 70840 |
934 | CD 38 ACC>ATC | Hb La Coruna | HBB:c.116C>T | β | Causative | β-chain variant | NG_000007.3 | 70840 |
2280 | CD 38 ACC>AGC | N/A | HBB:c.116C>G | β | Causative | β-chain variant | NG_000007.3 | 70840 |
141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
142 | CD 39 CAG>TAG [Gln>STOP] | N/A | HBB:c.118C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
935 | CD 39 CAG>AAG | Hb Alabama | HBB:c.118C>A | β | Causative | β-chain variant | NG_000007.3 | 70842 |
936 | CD 39 CAG>GAG | Hb Vaasa | HBB:c.118C>G | β | Causative | β-chain variant | NG_000007.3 | 70842 |
937 | CD 39 CAG>CGG [Gln>Arg] | Hb Tianshui | HBB:c.119A>G | β | Causative | β-chain variant | NG_000007.3 | 70843 |
2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
2962 | CD 39 CAG>CCG [Gln>Pro] | Hb Hyden | HBB:c.119A>C | β | Causative | β-chain variant | NG_000007.3 | 70843 |
938 | CD 39 CAG>CAC | Hb San Bruno | HBB:c.120G>C | β | Causative | β-chain variant | NG_000007.3 | 70844 |
4045 | CD 40 AGG>GGG [Arg>Gly] | Hb Montpellier | HBB:c.121A>G | β | Causative | β-chain variant | NG_000007.3 | 70845 |
2544 | CD 40 AGG>ACG [Arg>Thr] | Hb Alcorn County | HBB:c.122G>C | β | Causative | β-chain variant | NG_000007.3 | 70846 |
939 | CD 40 AGG>AAG [Arg>Lys] | Hb Athens-GA | HBB:c.122G>A | β | Causative | β-chain variant | NG_000007.3 | 70846 |
940 | CD 40 AGG>ATG [Arg>Met] | Hb Taipei-Tien | HBB:c.122G>T | β | Causative | β-chain variant | NG_000007.3 | 70846 |
143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
941 | CD 40 AGG>AGT [Arg>Ser] | Hb Austin | HBB:c.123G>T | β | Causative | β-chain variant | NG_000007.3 | 70847 |
3004 | CD 41 TTC>GTC [Phe>Val] | Hb Valme | HBB:c.124T>G | β | Causative | β-chain variant | NG_000007.3 | 70848 |
145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
942 | CD 41 TTC>TGC | Hb Ilmenau | HBB:c.125T>G | β | Causative | β-chain variant | NG_000007.3 | 70849 |
943 | CD 41 TTC>TCC | Hb Denver | HBB:c.125T>C | β | Causative | β-chain variant | NG_000007.3 | 70849 |
944 | CD 41 TTC>TAC | Hb Mequon | HBB:c.125T>A | β | Causative | β-chain variant | NG_000007.3 | 70849 |
146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
2387 | CD 67 GTG>ATG [Val>Met] AND CD 41 TTC>TTG [Phe>Leu] | Hb Brevedent | HBB:c.[202G>A ;126C>G] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70850 |
2972 | CD 41 TTC>TTA [Phe>Leu] | Hb Wilton | HBB:c.126C>A | β | Causative | β-chain variant | NG_000007.3 | 70850 |
2461 | CD 42 TTT>ATT [Phe>Ile] | Hb Oslo | HBB:c.127T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70851 |
945 | CD 42 (-TTT) | Hb Bruxelles | HBB:c.127_129delTTT | β | Causative | β-chain variant | NG_000007.3 | 70851 |
947 | CD 42 TTT>CTT [Phe>Leu] | Hb Louisville | HBB:c.127T>C | β | Causative | β-chain variant | NG_000007.3 | 70851 |
948 | CD 42 TTT>GTT (Hb Warsaw) | Hb Sendagi | HBB:c.127T>G | β | Causative | β-chain variant | NG_000007.3 | 70851 |
949 | CD 42 TTT>TCT [Phe>Ser] | Hb Hammersmith | HBB:c.128T>C | β | Causative | β-chain variant | NG_000007.3 | 70852 |
2332 | CD 42 TTT>TGT [Phe>Cys] | Hb Little Venice | HBB:c.128T>G | β | Causative | β-chain variant | NG_000007.3 | 70852 |
2954 | CD 42 TTT>TT- | Hb Yala | HBB:c.129delT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70853 |
4079 | CD 42 TTT>TTA [Phe>Leu] | Hb Suqian | HBB:c.129T>A | β | Causative | β-chain variant | NG_000007.3 | 70853 |
148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
950 | CD 43 GAG>CAG | Hb Hoshida | HBB:c.130G>C | β | Causative | β-chain variant | NG_000007.3 | 70854 |
951 | CD 43 GAG>AAG [Glu>Lys] | Hb Hornchurch | HBB:c.130G>A | β | Causative | β-chain variant | NG_000007.3 | 70854 |
3594 | CD 43 (GAG>TAG);CD 71/72 (+A) | N/A | HBB:c.[130G>T;217dupA] | β | Causative | β-thalassaemia | NG_000007.3 | 70854, 70941 |
946 | CD 43-46 (-9bp) | Hb Niteroi | HBB:c.131_139del | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70855 |
952 | CD 43 GAG>GGG [Glu>Gly] | Hb Haringey | HBB:c.131A>G | β | Causative | β-chain variant | NG_000007.3 | 70855 |
953 | CD 43 GAG>GCG | Hb G-Galveston | HBB:c.131A>C | β | Causative | β-chain variant | NG_000007.3 | 70855 |
954 | CD 44 TCC>TGC | Hb Mississippi | HBB:c.134C>G | β | Causative | β-chain variant | NG_000007.3 | 70858 |
3969 | CD 44 TCC>TTC [Ser>Phe] | Hb Narges Lab | HBB:c.134C>T | β | Causative | β-chain variant | NG_000007.3 | 70858 |
151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
2531 | CD 45 TTT>GTT [Phe>Val] | Hb Duc Pho | HBB:c.136T>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70860 |
955 | CD 45 TTT>TCT | Hb Cheverly | HBB:c.137T>C | β | Causative | β-chain variant | NG_000007.3 | 70861 |
956 | CD 45 TTT>TAT [Phe>Tyr] | Hb Den Haag | HBB:c.137T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70861 |
957 | CD 45 TTT>TGT | Hb Arta | HBB:c.137T>G | β | Causative | β-chain variant | NG_000007.3 | 70861 |
152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
154 | CD 45/46 (+A) | N/A | HBB:c.138_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
958 | CD 46 GGG>AGG | Hb Gainesville-GA | HBB:c.139G>A | β | Causative | β-chain variant | NG_000007.3 | 70863 |
3567 | CD 46 GGG>CGG [Gly>Arg] | Hb Cenxi | HBB:c.139G>C | β | Causative | β-chain variant | NG_000007.3 | 70863 |
959 | CD 46 GGG>GAG | Hb K-Ibadan | HBB:c.140G>A | β | Causative | β-chain variant | NG_000007.3 | 70864 |
960 | CD 47 GAT>AAT [Asp>Asn] | Hb G-Copenhagen | HBB:c.142G>A | β | Causative | β-chain variant | NG_000007.3 | 70866 |
961 | CD 47 GAT>CAT [Asp>His] | Hb Maryland | HBB:c.142G>C | β | Causative | β-chain variant | NG_000007.3 | 70866 |
962 | CD 47 GAT>TAT | Hb Maputo | HBB:c.142G>T | β | Causative | β-chain variant | NG_000007.3 | 70866 |
2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
963 | CD 47 GAT>GCT | Hb Avicenna | HBB:c.143A>C | β | Causative | β-chain variant | NG_000007.3 | 70867 |
964 | CD 47 GAT>GGT | Hb Gavello | HBB:c.143A>G | β | Causative | β-chain variant | NG_000007.3 | 70867 |
965 | CD 47 GAT>GTT | Hb Muravera | HBB:c.143A>T | β | Causative | β-chain variant | NG_000007.3 | 70867 |
966 | CD 48 CTG>CGG | Hb Okaloosa | HBB:c.146T>G | β | Causative | β-chain variant | NG_000007.3 | 70870 |
967 | CD 48 CTG>CCG | Hb Bab-Saadoun | HBB:c.146T>C | β | Causative | β-chain variant | NG_000007.3 | 70870 |
2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
3494 | CD 49 TCC>CCC [Ser>Pro] | Hb Yunnan | HBB:c.148T>C | β | Causative | β-chain variant | NG_000007.3 | 70872 |
2407 | CD 49-55 (-19 bp +4 bp) | Hb Martinez | HBB:c.149_167delinsAGCT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70873 |
968 | CD 49 TCC>TGC | Hb Colima | HBB:c.149C>G | β | Causative | β-chain variant | NG_000007.3 | 70873 |
969 | CD 49 TCC>TTC | Hb Las Palmas | HBB:c.149C>T | β | Causative | β-chain variant | NG_000007.3 | 70873 |
157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
970 | CD 50 ACT>TCT [Thr>Ser] | Hb Zurich-Langstrasse | HBB:c.151A>T | β | Causative | β-chain variant | NG_000007.3 | 70875 |
3571 | CD 50 ACT>GCT [Thr>Ala] | N/A | HBB:c.151A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70875 |
3940 | CD 50 ACT>TCT [Thr>Ser]; IVS II-654 C>T | Hb Zurich-Langstrasse | HBB:c.[151A>T;316-197C>T] | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70875, 71693 |
971 | CD 50 ACT>AAG or AAA | Hb Edmonton | HBB:c.[152C>A;153T>A] | HBB:c.[152C>A;153T>G] | β | Causative | β-chain variant | NG_000007.3 | 70876 |
158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
2049 | CD 50 ACT>ACA [Thr>Thr] | N/A | NG_000007.3:g.70877T>A | β | Neutral | N/A | NG_000007.3 | 70877 |
972 | CD 51 CCT>TCT, CD 52 GAT>AAT | Hb Grenoble | HBB:c.[154C>T;157G>A] | β | Causative | β-chain variant | NG_000007.3 | 70878 |
159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
973 | CD 51 CCT>CAT | Hb North Manchester | HBB:c.155C>A | β | Causative | β-chain variant | NG_000007.3 | 70879 |
974 | CD 51 CCT>CGT | Hb Willamette | HBB:c.155C>G | β | Causative | β-chain variant | NG_000007.3 | 70879 |
975 | CD 52 GAT>TAT [Asp>Tyr] | Hb Languidic | HBB:c.157G>T | β | Causative | β-chain variant | NG_000007.3 | 70881 |
976 | CD 52 GAT>CAT | Hb Summer Hill | HBB:c.157G>C | β | Causative | β-chain variant | NG_000007.3 | 70881 |
977 | CD 52 GAT>AAT | Hb Osu Christiansborg | HBB:c.157G>A | β | Causative | β-chain variant | NG_000007.3 | 70881 |
978 | CD 52 GAT>GGT | Hb Hokusetsu | HBB:c.158A>G | β | Causative | β-chain variant | NG_000007.3 | 70882 |
979 | CD 52 GAT>GCT | Hb Ocho Rios | HBB:c.158A>C | β | Causative | β-chain variant | NG_000007.3 | 70882 |
980 | CD 52 GAT>GTT [Asp>Val] | Hb Akron | HBB:c.158A>T | β | Causative | β-chain variant | NG_000007.3 | 70882 |
2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
982 | CD 53 GCT>ACT | Hb Acharnes | HBB:c.160G>A | β | Causative | β-chain variant | NG_000007.3 | 70884 |
2964 | CD 53 GCT>GTT [Ala>Val] | Hb Midnapore | HBB:c.161C>T | β | Causative | β-chain variant | NG_000007.3 | 70885 |
160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
3368 | CD 54 GTT>CTT [Val>Leu] | Hb Askew | HBB:c.163G>C | β | Causative | β-chain variant | NG_000007.3 | 70887 |
4094 | CD 54 GTT>-TT | N/A | HBB:c.163del | β | Causative | β-thalassaemia | NG_000007.3 | 70887 |
983 | CD 54 GTT>GAT | Hb Jacksonville | HBB:c.164T>A | β | Causative | β-chain variant | NG_000007.3 | 70888 |
162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
984 | CD 55 ATG>AAG | Hb Matera | HBB:c.167T>A | β | Causative | β-chain variant | NG_000007.3 | 70891 |
2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
985 | CD 56 GGC>TGC | Hb Leeds | HBB:c.169G>T | β | Causative | β-chain variant | NG_000007.3 | 70893 |
986 | CD 56 GGC>CGC | Hb Hamadan | HBB:c.169G>C | β | Causative | β-chain variant | NG_000007.3 | 70893 |
987 | CD 56 GGC>CGC; CD 86 GCC>CCC | Hb Poissy | HBB:c.[169G>C;259G>C] | β | Causative | β-chain variant | NG_000007.3 | 70893 |
166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
988 | CD 56 GGC>GAC (Hb J-Korat , Hb J-Manado , Hb J-Meinung) | Hb J-Bangkok | HBB:c.170G>A | β | Causative | β-chain variant | NG_000007.3 | 70894 |
989 | CD 56-60 (-12bp) | Hb Tochigi | HBB:c.170_181del | β | Causative | β-chain variant | NG_000007.3 | 70894 |
3780 | CD 56 GGC>GGT [Gly>Gly] | N/A | HBB:c.171C>T | β | Neutral | N/A | NG_000007.3 | 70895 |
990 | CD 57 AAC>CAC [Asn>His] | Hb Sidcup | HBB:c.172A>C | β | Causative | β-chain variant | NG_000007.3 | 70896 |
991 | CD 57 AAC>GAC | Hb J-Daloa | HBB:c.172A>G | β | Causative | β-chain variant | NG_000007.3 | 70896 |
992 | CD 57 AAC>ACC [Asn>Thr] | Hb Viseu | HBB:c.173A>C | β | Causative | β-chain variant | NG_000007.3 | 70897 |
2333 | CD 57 AAC>AGC [Asn>Ser] | Hb Cork | HBB:c.173A>G | β | Causative | β-chain variant | NG_000007.3 | 70897 |
3779 | CD 57 AAC>AAT [Asn>Asn] | N/A | HBB:c.174C>T | β | Neutral | N/A | NG_000007.3 | 70898 |
993 | CD 57 AAC>AAA or AAG | Hb G-Ferrara | HBB:c.174C>A | HBB:c.174C>G | β | Causative | β-chain variant | NG_000007.3 | 70898 |
167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
994 | CD 58 CCT>CAT [Pro>His] | Hb Sheffield | HBB:c.176C>A | β | Causative | β-chain variant | NG_000007.3 | 70900 |
995 | CD 58 CCT>CGT [Pro>Arg] | Hb Dhofar | HBB:c.176C>G | β | Causative | β-chain variant | NG_000007.3 | 70900 |
3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
2998 | CD 59 AAG>CAG [ Lys>Gln] | Hb Hillsborought | HBB:c.178A>C | β | Causative | β-chain variant | NG_000007.3 | 70902 |
3061 | CD 59 (+T) | N/A | HBB:c.178_179insT | β | Causative | β-thalassaemia | NG_000007.3 | 70902 |
169 | CD 59 (AAG>TAG) | N/A | HBB:c.178A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70902 |
996 | CD 59 AAG>GAG | Hb I-High Wycombe | HBB:c.178A>G | β | Causative | β-chain variant | NG_000007.3 | 70902 |
168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
997 | CD 59 AAG>ACG [Lys>Thr] | Hb J-Kaohsiung | HBB:c.179A>C | β | Causative | β-chain variant | NG_000007.3 | 70903 |
3747 | CD 59 AAG>ATG [Lys>Met] | Hb Dahua | HBB:c.179A>T | β | Causative | β-chain variant | NG_000007.3 | 70903 |
4086 | CD 59 AAG>AA-, CD 59 (-G) | N/A | HBB:c.180del | β | Causative | β-thalassaemia | NG_000007.3 | 70904 |
998 | CD 59 AAG>AAC or AAT | Hb J-Lome | HBB:c.180G>C | HBB:c.180G>T | β | Causative | β-chain variant | NG_000007.3 | 70904 |
2050 | CD 59 AAG>AAA [Lys>Lys] | N/A | HBB:c.180G>A | β | Neutral | N/A | NG_000007.3 | 70904 |
999 | CD 60 GTG>CTG [Val>Leu] | Hb Yatsushiro | HBB:c.181G>C | β | Causative | β-chain variant | NG_000007.3 | 70905 |
3855 | CD 60 GTG>-TG [Val>STOP] | N/A | HBB:c.181delG | β | Causative | β-thalassaemia | NG_000007.3 | 70905 |
3298 | CD 60-61 (-6bp): (-TGAAGG) | Hb Tavapy | HBB:c.182_187delTGAAGG | β | Causative | β-chain variant | NG_000007.3 | 70906 |
170 | CD 60 GTG>GAG [Val>Glu] | Hb Cagliari | HBB:c.182T>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70906 |
1000 | CD 60 GTG>GCG [Leu>Ala] | Hb Collingwood | HBB:c.182T>C | β | Causative | β-chain variant | NG_000007.3 | 70906 |
172 | CD 61 (AAG>TAG) | N/A | HBB:c.184A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70908 |
1002 | CD 61 AAG>CAG | Hb Pocos de Caldas | HBB:c.184A>C | β | Causative | β-chain variant | NG_000007.3 | 70908 |
1003 | CD 61 AAG>GAG | Hb N-Seattle | HBB:c.184A>G | β | Causative | β-chain variant | NG_000007.3 | 70908 |
1004 | CD 61 AAG>ATG | Hb Bologna | HBB:c.185A>T | β | Causative | β-chain variant | NG_000007.3 | 70909 |
1005 | CD 61 AAG>AAC or AAT [Lys>Asn] | Hb Hikari | HBB:c.186G>C | HBB:c.186G>T | β | Causative | β-chain variant | NG_000007.3 | 70910 |
1006 | CD 62 GCT>CCT | Hb Duarte | HBB:c.187G>C | β | Causative | β-chain variant | NG_000007.3 | 70911 |
2190 | CD 62-83 (+65 bp) | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70911 |
3589 | CD 62-65 (-12bp) | N/A | HBB:c.187_198delGCTCATGGCAAG | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
3342 | CD 62 GCT>GTT [Ala>Val] | Hb Hachioji | HBB:c.188C>T | β | Causative | β-chain variant | NG_000007.3 | 70912 |
1007 | CD 62 GCT>GAT | Hb J-Europa | HBB:c.188C>A | β | Causative | β-chain variant | NG_000007.3 | 70912 |
171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
1008 | CD 63 CAT>AAT [His>Asn] | Hb Haná | HBB:c.190C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70914 |
1009 | CD 63 CAT>TAT (Hb Hörlein-Weber, Hb Leipzig, Hb M-Arhus, Hb M-Chicago, Hb M-Emory, Hb M-Erlangen, Hb M-Hamburg, Hb M-Hida, Hb M-Kurume, Hb M-Radom, Hb Novi Sad) | Hb M-Saskatoon | HBB:c.190C>T | β | Causative | β-chain variant | NG_000007.3 | 70914 |
1010 | CD 63 CAT>CCT | Hb Bicêtre | HBB:c.191A>C | β | Causative | β-chain variant | NG_000007.3 | 70915 |
1011 | CD 63 CAT>CGT [His>Arg] (Hb Zurich) | Hb Zürich | HBB:c.191A>G | β | Causative | β-chain variant | NG_000007.3 | 70915 |
2456 | CD 63 CAT>CTT [His>Leu] | Hb Temple Street | HBB:c.191A>T | β | Causative | β-chain variant | NG_000007.3 | 70915 |
3629 | CD 64 GGC>AGC [Gly>Ser] | Hb Hezhou | HBB:c.193G>A | β | Causative | β-chain variant | NG_000007.3 | 70917 |
2976 | CD 64 GGC>GTC [Gly>Val] | Hb Calgary | HBB:c.194G>T | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70918 |
3944 | CD 64 (+G) | N/A | HBB:c.194dup | β | Causative | β-thalassaemia | NG_000007.3 | 70918 |
173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
1012 | CD 64 GGC>GCC | Hb Aubagne | HBB:c.194G>C | β | Causative | β-chain variant | NG_000007.3 | 70918 |
1013 | CD 64 GGC>GAC | Hb J-Calabria | HBB:c.194G>A | β | Causative | β-chain variant | NG_000007.3 | 70918 |
1014 | CD 65 AAG>CAG | Hb J-Cairo | HBB:c.196A>C | β | Causative | β-chain variant | NG_000007.3 | 70920 |
3559 | CD 65 AAG>GAG [Lys>Glu] | Hb Guangxi | HBB:c.196A>G | β | Causative | β-chain variant | NG_000007.3 | 70920 |
1016 | CD 65 AAG>ATG | Hb J-Antakya | HBB:c.197A>T | β | Causative | β-chain variant | NG_000007.3 | 70921 |
1017 | CD 65 AAG>AAC or AAT | Hb J-Sicilia | HBB:c.198G>C | HBB:c.198G>T | β | Causative | β-chain variant | NG_000007.3 | 70922 |
174 | CD 66 AAA>TAA [Lys>STOP] | N/A | HBB:c.199A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
1018 | CD 66 AAA>GAA | Hb I-Toulouse | HBB:c.199A>G | β | Causative | β-chain variant | NG_000007.3 | 70923 |
2525 | CD 68/69 (+AAAGTGCTC) | Hb Bronx | HBB:c.199_207dupAAAGTGCTC | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70923 |
3854 | CD 66/67 (-AAAG) | N/A | HBB:c.199_202delAAAG | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
3367 | CD 66 AAA>ATA [Lys>Ile] | Hb Vigo | HBB:c.200A>T | β | Causative | β-chain variant | NG_000007.3 | 70924 |
1019 | CD 66 AAA>ACA | Hb Chico | HBB:c.200A>C | β | Causative | β-chain variant | NG_000007.3 | 70924 |
1020 | CD 66 AAA>AAT | Hb Ulm | HBB:c.201A>T | β | Causative | β-chain variant | NG_000007.3 | 70925 |
2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
1021 | CD 67 GTG>ATG [Val>Met] (Hb Bristol-Alesha, Hb Bristol) | Hb Alesha | HBB:c.202G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70926 |
175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
1023 | CD 67 GTG>GGG [Val>Gly] | Hb Manukau | HBB:c.203T>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70927 |
1024 | CD 67 GTG>GAG | Hb M-Milwaukee-I | HBB:c.203T>A | β | Causative | β-chain variant | NG_000007.3 | 70927 |
1025 | CD 67 GTG>GCG | Hb Sydney | HBB:c.203T>C | β | Causative | β-chain variant | NG_000007.3 | 70927 |
1029 | CD 69 (+GCTCGG) | Hb Nishinomiya | HBB:c.204_209dupGCTCGG | β | Causative | β-chain variant | NG_000007.3 | 70928 |
1026 | CD 68 CTC>TTC | Hb Loves Park | HBB:c.205C>T | β | Causative | β-chain variant | NG_000007.3 | 70929 |
1027 | CD 68 CTC>CAC | Hb Brisbane | HBB:c.206T>A | β | Causative | β-chain variant | NG_000007.3 | 70930 |
1028 | CD 68 CTC>CCC [Leu>Pro] | Hb Mizuho | HBB:c.206T>C | β | Causative | β-chain variant | NG_000007.3 | 70930 |
3019 | CD 68-70 (-7bp): (-TCGGTGC) | N/A | HBB:c.206_212delTCGGTGC | β | Causative | β-thalassaemia | NG_000007.3 | 70930 |
3778 | CD 68 CTC>CTT [Leu>Leu] | N/A | HBB:c.207C>T | β | Neutral | N/A | NG_000007.3 | 70931 |
3851 | CD 68 CTC>CTA [Leu>Leu] | N/A | HBB:c.207C>A | β | Neutral | N/A | NG_000007.3 | 70931 |
3798 | CD 69 GGT>TGT [Gly>Cys] | Hb Miguel Servet | HBB:c.208G>T | β | Causative | β-chain variant | NG_000007.3 | 70932 |
1030 | CD 69 GGT>AGT | Hb City of Hope | HBB:c.208G>A | β | Causative | β-chain variant | NG_000007.3 | 70932 |
1031 | CD 69 GGT>CGT | Hb Kenitra | HBB:c.208G>C | β | Causative | β-chain variant | NG_000007.3 | 70932 |
1032 | CD 69 GGT>GAT | Hb Rambam | HBB:c.209G>A | β | Causative | β-chain variant | NG_000007.3 | 70933 |
2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
3799 | CD 70 GCC>ACC [Ala>Thr] | Hb La Mesa | HBB:c.211G>A | β | Causative | β-chain variant | NG_000007.3 | 70935 |
1033 | CD 70 GCC>CCC [Ala>Pro] | Hb Abington | HBB:c.211G>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70935 |
1034 | CD 70 GCC>GAC | Hb Seattle | HBB:c.212C>A | β | Causative | β-chain variant | NG_000007.3 | 70936 |
1035 | CD 70 GCC>GGC [Ala>Gly] | Hb Hershey | HBB:c.212C>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70936 |
1036 | CD 70 GCC>GTC | Hb Marineo | HBB:c.212C>T | β | Causative | β-chain variant | NG_000007.3 | 70936 |
1037 | CD 71 TTT>TCT | Hb Christchurch | HBB:c.215T>C | β | Causative | β-chain variant | NG_000007.3 | 70939 |
2969 | CD 71 TTT>TAT [Phe>Tyr] | Hb Saint-Clair | HBB:c.215T>A | β | Causative | β-chain variant | NG_000007.3 | 70939 |
2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
2401 | CD 72 AGT>ACT [Ser>Thr] | Hb Phimai | HBB:c.218G>C | β | Causative | β-chain variant | NG_000007.3 | 70942 |
2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
3374 | CD 72 AGT>AGA [Ser>Arg]; CD 73 GAT>TAT [Asp>Tyr] | Hb South China | HBB:c.[219T>A;220G>T] | β | Causative | β-thalassaemia | NG_000007.3 | 70943, 70944 |
1038 | CD 72 AGT>AGA | Hb Headington | HBB:c.219T>A | β | Causative | β-chain variant | NG_000007.3 | 70943 |
1039 | CD 73 GAT>TAT | Hb Vancouver | HBB:c.220G>T | β | Causative | β-chain variant | NG_000007.3 | 70944 |
1040 | CD 73 GAT>AAT (Hb Korle-Bu) | Hb G-Accra | HBB:c.220G>A | β | Causative | β-chain variant | NG_000007.3 | 70944 |
1043 | CD 73-75 (-GATGGCCTG; + Ala-Arg-Cys-Gln) | Hb Montreal | HBB:c.220_228delinsGCTCGGTGCCAG | β | Causative | β-chain variant | NG_000007.3 | 70944 |
2478 | CD 73 GAT>TAT>TTT [Asp>Phe] | Hb Meylan | HBB:c.[220G>T ;221A>T] | β | Causative | β-chain variant | NG_000007.3 | 70944 |
1041 | CD 73 GAT>GGT | Hb Tilburg | HBB:c.221A>G | β | Causative | β-chain variant | NG_000007.3 | 70945 |
1042 | CD 73 GAT>GTT | Hb Mobile | HBB:c.221A>T | β | Causative | β-chain variant | NG_000007.3 | 70945 |
1045 | CD 74 GGC>AGC [Gly>Ser] | Hb Kokomo | HBB:c.223G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70947 |
1046 | CD 74 GGC>CGC [Gly>Arg] | Hb Aalborg | HBB:c.223G>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70947 |
1044 | CD 74-76 (-GCCTGG) | Hb Saint-Antoine | HBB:c.224_229delGCCTGG | β | Causative | β-chain variant | NG_000007.3 | 70948 |
1047 | CD 74 GGC>GTC | Hb Bushwick | HBB:c.224G>T | β | Causative | β-chain variant | NG_000007.3 | 70948 |
1048 | CD 74 GGC>GAC | Hb Shepherds Bush | HBB:c.224G>A | β | Causative | β-chain variant | NG_000007.3 | 70948 |
179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
1049 | CD 75 (-CTG) | Hb Vicksburg | HBB:c.226_228delCTG | β | Causative | β-chain variant | NG_000007.3 | 70950 |
1050 | CD 75 CTG>CCG; CD 141 (-CTG) | Hb Atlanta-Coventry | HBB:c.[227T>C;424_426delCTG] | β | Causative | β-chain variant | NG_000007.3 | 70951 |
1051 | CD 75 CTG>CCG | Hb Atlanta | HBB:c.227T>C | β | Causative | β-chain variant | NG_000007.3 | 70951 |
1052 | CD 75 CTG>CGG | Hb Pasadena | HBB:c.227T>G | β | Causative | β-chain variant | NG_000007.3 | 70951 |
4080 | CD 75 CTG>CAG [Leu>Gln] | Hb Raklev | HBB:c.227T>A | β | Causative | β-chain variant | NG_000007.3 | 70951 |
180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
1053 | CD 76 GCT>CCT | Hb Calais | HBB:c.229G>C | β | Causative | β-chain variant | NG_000007.3 | 70953 |
181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
1054 | CD 76 GCT>GTT [Ala>Val] | Hb Harlequin | HBB:c.230C>T | β | Causative | β-chain variant | NG_000007.3 | 70954 |
1055 | CD 76 GCT>GAT | Hb J-Chicago | HBB:c.230C>A | β | Causative | β-chain variant | NG_000007.3 | 70954 |
1056 | CD 77 CAC>TAC; CD 80 AAC>AGC | Hb Villeparisis | HBB:c.[232C>T;242A>G] | β | Causative | β-chain variant | NG_000007.3 | 70956 |
1057 | CD 77 CAC>TAC | Hb Fukuyama | HBB:c.232C>T | β | Causative | β-chain variant | NG_000007.3 | 70956 |
1058 | CD 77 CAC>GAC | Hb J-Iran | HBB:c.232C>G | β | Causative | β-chain variant | NG_000007.3 | 70956 |
2405 | CD 77 CAC>AAC [His>Asn] | Hb Heilbronn | HBB:c.232C>A | β | Causative | β-chain variant | NG_000007.3 | 70956 |
2533 | CD 77 CAC>CCC [His>Pro] | Hb Brooklyn | HBB:c.233A>C | β | Causative | β-chain variant | NG_000007.3 | 70957 |
1059 | CD 77 CAC>CTC [His>Leu] | Hb St. Joseph's | HBB:c.233A>T | β | Causative | β-chain variant | NG_000007.3 | 70957 |
1060 | CD 77 CAC>CGC [His>Arg] | Hb Costa Rica | HBB:c.233A>G | β | Causative | β-chain variant | NG_000007.3 | 70957 |
1061 | CD 77 CAC>CAG | Hb Vienna | HBB:c.234C>G | β | Causative | β-chain variant | NG_000007.3 | 70958 |
182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
2422 | CD 78 CTG>GTG [Leu>Val] | Hb Ullevaal | HBB:c.235C>G | β | Causative | β-chain variant | NG_000007.3 | 70959 |
3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
3371 | CD 78 CTG>CCG [Leu>Pro] | Hb Penang | HBB:c.236T>C | β | Causative | β-chain variant | NG_000007.3 | 70960 |
1062 | CD 78 CTG>CGG | Hb Quin-Hai | HBB:c.236T>G | β | Causative | β-chain variant | NG_000007.3 | 70960 |
3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
1063 | CD 79 GAC>CAC | Hb Tigraye | HBB:c.238G>C | β | Causative | β-chain variant | NG_000007.3 | 70962 |
1064 | CD 79 GAC>AAC | Hb Yaizu | HBB:c.238G>A | β | Causative | β-chain variant | NG_000007.3 | 70962 |
1065 | CD 79 GAC>TAC | Hb Tampa | HBB:c.238G>T | β | Causative | β-chain variant | NG_000007.3 | 70962 |
1066 | CD 79 GAC>GGC [Asp>Gly] | Hb G-Hsi-Tsou | HBB:c.239A>G | β | Causative | β-chain variant | NG_000007.3 | 70963 |
3310 | CD 79 GAC>GCC [Asp>Ala] | Hb Torbay | HBB:c.239A>C | β | Causative | β-chain variant | NG_000007.3 | 70963 |
3919 | CD 79 GAC>GAA [Asp>Glu] | Hb Kalundborg | HBB:c.240C>A | β | Causative | β-chain variant | NG_000007.3 | 70964 |
2307 | CD 80 AAC>CAC [Asn>His] | Hb East Timor | HBB:c.241A>C | β | Causative | β-chain variant | NG_000007.3 | 70965 |
2391 | CD 80 AAC>GAC [Asn>Asp] | Hb Valley Park | HBB:c.241A>G | β | Causative | β-chain variant | NG_000007.3 | 70965 |
2445 | CD 80 -AAC [-Asn] | Hb Saint-Chamond | HBB:c.241_243delAAC | β | Causative | β-chain variant | NG_000007.3 | 70965 |
1067 | CD 80 AAC>TAC [Asn>Tyr] | Hb Hounslow | HBB:c.241A>T | β | Causative | β-chain variant | NG_000007.3 | 70965 |
3392 | CD 80 AAC>AGC [Asn>Ser] | Hb Moncloa | HBB:c.242A>G | β | Causative | β-chain variant | NG_000007.3 | 70966 |
1068 | CD 80 AAC>AAG [Asn>Lys] (Hb Gifu) | Hb G-Szuhu | HBB:c.243C>G | β | Causative | β-chain variant | NG_000007.3 | 70967 |
183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
2443 | CD 81 CTC>TTC [Leu>Phe] | Hb Seville | HBB:c.244C>T | β | Causative | β-chain variant | NG_000007.3 | 70968 |
1069 | CD 81 CTC>CGC | Hb Baylor | HBB:c.245T>G | β | Causative | β-chain variant | NG_000007.3 | 70969 |
1070 | CD 81 CTC>CAC | Hb La Roche-sur-Yon | HBB:c.245T>A | β | Causative | β-chain variant | NG_000007.3 | 70969 |
3777 | CD 81 CTC>CTG [Leu>Leu] | N/A | HBB:c.246C>G | β | Neutral | N/A | NG_000007.3 | 70970 |
1071 | CD 82 AAG>CAG | Hb Tsurumai | HBB:c.247A>C | β | Causative | β-chain variant | NG_000007.3 | 70971 |
1072 | CD 82 AAG>GAG | Hb Gàmbara | HBB:c.247A>G | β | Causative | β-chain variant | NG_000007.3 | 70971 |
1073 | CD 82 AAG>ACG | Hb Rahere | HBB:c.248A>C | β | Causative | β-chain variant | NG_000007.3 | 70972 |
1074 | CD 82 AAG>ATG | Hb Helsinki | HBB:c.248A>T | β | Causative | β-chain variant | NG_000007.3 | 70972 |
1075 | CD 82 AAG>AGG | Hb Taradale | HBB:c.248A>G | β | Causative | β-chain variant | NG_000007.3 | 70972 |
1076 | CD 82 AAG>AAC | Hb Providence | HBB:c.249G>C | β | Causative | β-chain variant | NG_000007.3 | 70973 |
1077 | CD 83 GGC>CGC [Gly>Arg] | Hb Muskegon | HBB:c.250G>C | β | Causative | β-chain variant | NG_000007.3 | 70974 |
1078 | CD 83 GGC>TGC [Gly>Cys] | Hb Ta-Li | HBB:c.250G>T | β | Causative | β-chain variant | NG_000007.3 | 70974 |
2534 | CD 83 GGC>AGC [Gly>Ser] | Hb Basking Ridge | HBB:c.250G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70974 |
185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
1079 | CD 83 GGC>GAC | Hb Pyrgos | HBB:c.251G>A | β | Causative | β-chain variant | NG_000007.3 | 70975 |
186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
1080 | CD 84 ACC>GCC | Hb Saale | HBB:c.253A>G | β | Causative | β-chain variant | NG_000007.3 | 70977 |
1081 | CD 84 ACC>AAC [Thr>Asn] | Hb Beaujolais | HBB:c.254C>A | β | Causative | β-chain variant | NG_000007.3 | 70978 |
1082 | CD 84 ACC>ATC | Hb Kofu | HBB:c.254C>T | β | Causative | β-chain variant | NG_000007.3 | 70978 |
187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
3965 | CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG) (Hb Donguan-Dongcheng) | Hb Wanjiang | HBB:c.255_264delinsTTTTTCTCAG | β | Causative | β-chain variant | NG_000007.3 | 70979 |
3323 | CD 85 TTT>CTT [Phe>Leu] | Hb San Martin | HBB:c.256T>C | β | Causative | β-chain variant | NG_000007.3 | 70980 |
2975 | CD 85 TTT>TGT [Phe>Cys] | Hb Grantham | HBB:c.257T>G | β | Causative | β-chain variant | NG_000007.3 | 70981 |
1083 | CD 85 TTT>TCT (Hb Bryn Mawr) | Hb Buenos Aires | HBB:c.257T>C | β | Causative | β-chain variant | NG_000007.3 | 70981 |
188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
3586 | CD 85 TTT>TTG [Phe>Leu] | Hb Kennisis | HBB:c.258T>G | β | Causative | β-chain variant | NG_000007.3 | 70982 |
3065 | CD 86 GCC>ACC [Ala>Thr] | Hb Seoul | HBB:c.259G>A | β | Causative | β-chain variant | NG_000007.3 | 70983 |
1084 | CD 86 GCC>CCC | Hb Cardarelli | HBB:c.259G>C | β | Causative | β-chain variant | NG_000007.3 | 70983 |
1085 | CD 86 GCC>ACC>ATC [Ala>Ile] | Hb Nebraska | HBB:c.[259G>A;260C>T] | β | Causative | β-chain variant | NG_000007.3 | 70983 |
1086 | CD 86 GCC>GAC | Hb Olomouc | HBB:c.260C>A | β | Causative | β-chain variant | NG_000007.3 | 70984 |
2454 | CD 86 GCC>GTC [Ala>Val] | Hb Izmir | HBB:c.260C>T | β | Causative | β-chain variant | NG_000007.3 | 70984 |
3722 | CD 86 GCC>GC- | N/A | HBB:c.261delC | β | Causative | β-thalassaemia | NG_000007.3 | 70985 |
1087 | CD 87 (-ACA) | Hb Tours | HBB:c.262_264delACA | β | Causative | β-chain variant | NG_000007.3 | 70986 |
1088 | CD 87 ACA>CCA | Hb Valletta | HBB:c.262A>C | β | Causative | β-chain variant | NG_000007.3 | 70986 |
1089 | CD 87 ACA>ATA | Hb Quebec-Chori | HBB:c.263C>T | β | Causative | β-chain variant | NG_000007.3 | 70987 |
1090 | CD 87 ACA>AAA | Hb D-Ibadan | HBB:c.263C>A | β | Causative | β-chain variant | NG_000007.3 | 70987 |
3377 | CD 87 ACA>AGA [Thr>Arg] | Hb Saint Jean d Ardieres | HBB:c.263C>G | β | Causative | β-chain variant | NG_000007.3 | 70987 |
4044 | CD 87-91 (-14 bp) | N/A | HBB:c.263_276del | β | Causative | β-thalassaemia | NG_000007.3 | 70987 |
3009 | CD 88 CTG>ATG [Leu>Met] | Hb NISER | HBB:c.265C>A | β | Causative | β-chain variant | NG_000007.3 | 70989 |
3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
1091 | CD 88 CTG>GTG [Leu>Val] | Hb Oofuna | HBB:c.265C>G | β | Causative | β-chain variant | NG_000007.3 | 70989 |
189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
1092 | CD 88 CTG>CGG | Hb Borås | HBB:c.266T>G | β | Causative | β-chain variant | NG_000007.3 | 70990 |
1093 | CD 88 CTG>CCG | Hb Santa Ana | HBB:c.266T>C | β | Causative | β-chain variant | NG_000007.3 | 70990 |
2051 | CD 88 CTG>CTC [Leu>Leu] | N/A | NG_000007.3:g.70991G>C | β | Neutral | N/A | NG_000007.3 | 70991 |
3287 | CD 89-93 (-14bp): (-AGTGAGCTGCACTG) | N/A | HBB:c.268_281delAGTGAGCTGCACTG | β | Causative | β-thalassaemia | NG_000007.3 | 70992 |
1095 | CD 89 AGT>AAT | Hb Créteil | HBB:c.269G>A | β | Causative | β-chain variant | NG_000007.3 | 70993 |
1096 | CD 89 AGT>ACT | Hb Villaverde | HBB:c.269G>C | β | Causative | β-chain variant | NG_000007.3 | 70993 |
191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
1094 | CD 89 AGT>AGR [Ser>Arg] | Hb Vanderbilt | HBB:c.270T>R | β | Causative | β-chain variant | NG_000007.3 | 70994 |
2965 | CD 89-90 (-TGAG) | Hb Wilde | HBB:c.270_273delTGAG | β | Causative | β-chain variant | NG_000007.3 | 70994 |
2491 | CD 90 GAG>CAG [Glu>Gln] | Hb Henan | HBB:c.271G>C | β | Causative | β-chain variant | NG_000007.3 | 70995 |
3044 | CD 90 GAG>-AG | N/A | HBB:c.271delG | β | Causative | β-thalassaemia | NG_000007.3 | 70995 |
192 | CD 90 GAG>TAG | N/A | HBB:c.271G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70995 |
1097 | CD 90 GAG>AAG | Hb Agenogi | HBB:c.271G>A | β | Causative | β-chain variant | NG_000007.3 | 70995 |
1118 | CD 94/95 +15 bp [+Glu-Leu-His-Cys-Asp] | Hb Fairfax | HBB:c.271_285dupGAGCTGCACTGTGAC | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70995 |
1098 | CD 90 GAG>GGG | Hb Roseau-Pointe a Pitre | HBB:c.272A>G | β | Causative | β-chain variant | NG_000007.3 | 70996 |
3057 | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | N/A | HBB:c.272_295dup | β | Causative | β-thalassaemia | NG_000007.3 | 70996 |
3593 | CD 90 GAG>GCG [Glu>Ala] | Hb Shenzhen | HBB:c.272A>C | β | Causative | β-chain variant | NG_000007.3 | 70996 |
1099 | CD 90 GAG>GAC [Glu>Asp] | Hb Pierre-Bénite | HBB:c.273G>C | β | Causative | β-chain variant | NG_000007.3 | 70997 |
1124 | CD 95/96 (+15 bp) | Hb Koriyama | HBB:c.274_288dup | β | Causative | β-chain variant | NG_000007.3 | 70998 |
3133 | IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu] | N/A | HBB:c.[315+1G>A; 274C>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70998, 71040 |
193 | CD 91 CTG>C-G | Hb Morgantown | HBB:c.275del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
1101 | CD 91 CTG>CCG | Hb Sabine | HBB:c.275T>C | β | Causative | β-chain variant | NG_000007.3 | 70999 |
1102 | CD 91 CTG>CGG | Hb Caribbean | HBB:c.275T>G | β | Causative | β-chain variant | NG_000007.3 | 70999 |
1103 | CD 92 CAC>GAC | Hb J-Altgeld Gardens | HBB:c.277C>G | β | Causative | β-chain variant | NG_000007.3 | 71001 |
1104 | CD 92 CAC>TAC (Hb M-Akita, Hb M-Hyde Park) | Hb M-Milwaukee-2 | HBB:c.277C>T | β | Causative | β-chain variant | NG_000007.3 | 71001 |
1105 | CD 92 CAC>AAC | Hb Redondo | HBB:c.277C>A | β | Causative | β-chain variant | NG_000007.3 | 71001 |
1106 | CD 92 CAC>CCC | Hb Newcastle | HBB:c.278A>C | β | Causative | β-chain variant | NG_000007.3 | 71002 |
1107 | CD 92 CAC>CGC | Hb Mozhaisk | HBB:c.278A>G | β | Causative | β-chain variant | NG_000007.3 | 71002 |
1108 | CD 92 CAC>CCC; CD 104 AGG>AGC | Hb Duino | HBB:c.[278A>C;315G>C] | β | Causative | β-chain variant | NG_000007.3 | 71002, 71039 |
1109 | CD 92 CAC>CAG [His>Gln] (Hb Istanbul) | Hb Saint Etienne | HBB:c.279C>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71003 |
1100 | CD 93-97 (-15 bp) | Hb Gun Hill | Hb GH | HBB:c.280_294delTGTGACAAGCTGCAC | β | Causative | β-chain variant | NG_000007.3 | 71004 |
1110 | CD 93 TGT>CGT: CD 121 GAA>CAA | Hb Cleveland | HBB:c.[280T>C;364G>C] | β | Causative | β-chain variant | NG_000007.3 | 71004 |
1111 | CD 93 TGT>CGT | Hb Okazaki | HBB:c.280T>C | β | Causative | β-chain variant | NG_000007.3 | 71004 |
1112 | CD 93 TGT>TAT | Hb Fort Dodge | HBB:c.281G>A | β | Causative | β-chain variant | NG_000007.3 | 71005 |
2442 | CD 93 TGT>TCT [Cys>Ser] | Hb Riesa | HBB:c.281G>C | β | Causative | β-chain variant | NG_000007.3 | 71005 |
2441 | CD 93 TGT>TGG [Cys>Trp] | Hb Santa Giusta Sardegna | HBB:c.282T>G | β | Causative | β-chain variant | NG_000007.3 | 71006 |
195 | CD 93/94 (+TG) | Hb Agnana | HBB:c.282_283dupTG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71006 |
1114 | CD 94 GAC>TAC | Hb Geldrop St Anna | HBB:c.283G>T | β | Causative | β-chain variant | NG_000007.3 | 71007 |
1115 | CD 94 GAC>CAC | Hb Barcelona | HBB:c.283G>C | β | Causative | β-chain variant | NG_000007.3 | 71007 |
1116 | CD 94 GAC>AAC | Hb Bunbury | HBB:c.283G>A | β | Causative | β-chain variant | NG_000007.3 | 71007 |
1117 | CD 94 GAC>GGC | Hb Chandigarh | HBB:c.284A>G | β | Causative | β-chain variant | NG_000007.3 | 71008 |
1119 | CD 95 AAG>GAG (Hb Hopkins-I, Hb Jenkins, Hb N-Memphis, Hb Kenwood) | Hb N-Baltimore | HBB:c.286A>G | β | Causative | β-chain variant | NG_000007.3 | 71010 |
2545 | CD 95 AAG>CAG [Lys>Gln] | Hb J-Valencia | HBB:c.286A>C | β | Causative | β-chain variant | NG_000007.3 | 71010 |
196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
1120 | CD 95 AAG>ATG | Hb J-Cordoba | HBB:c.287A>T | β | Causative | β-chain variant | NG_000007.3 | 71011 |
1121 | CD 95 AAG>AAY [Lys>Asn] | Hb Detroit | HBB:c.288G>Y | β | Causative | β-chain variant | NG_000007.3 | 71012 |
3776 | CD 95 AAG>AAA [Lys>Lys] | N/A | HBB:c.288G>A | β | Neutral | N/A | NG_000007.3 | 71012 |
1122 | CD 96 CTG>GTG | Hb Regina | HBB:c.289C>G | β | Causative | β-chain variant | NG_000007.3 | 71013 |
1123 | CD 96 CTG>CCG | Hb Debrousse | HBB:c.290T>C | β | Causative | β-chain variant | NG_000007.3 | 71014 |
3876 | CD 96 CTG>CGG [Leu>Arg] | Hb Laibin | HBB:c.290T>G | β | Causative | β-chain variant | NG_000007.3 | 71014 |
3888 | CD 97/98 (+GCAC) | N/A | HBB:c.291_294dup | β | Causative | β-thalassaemia | NG_000007.3 | 71015 |
1126 | CD 97 CAC>TAC | Hb Moriguchi | HBB:c.292C>T | β | Causative | β-chain variant | NG_000007.3 | 71016 |
1127 | CD 97 CAC>AAC | Hb Santa Clara | HBB:c.292C>A | β | Causative | β-chain variant | NG_000007.3 | 71016 |
1125 | CD 97/98 (-ACG) | Hb Galicia | HBB:c.293_295delACG | β | Causative | β-chain variant | NG_000007.3 | 71017 |
1128 | CD 97 CAC>CTC | Hb Wood | HBB:c.293A>T | β | Causative | β-chain variant | NG_000007.3 | 71017 |
1129 | CD 97 CAC>CCC | Hb Nagoya | HBB:c.293A>C | β | Causative | β-chain variant | NG_000007.3 | 71017 |
1130 | CD 97 CAC>CAA, also CAC>CAG | Hb Malmö | HBB:c.294C>A | HBB:c.294C>G | β | Causative | β-chain variant | NG_000007.3 | 71018 |
1131 | CD 98 GTG>ATG [Val>Met] (Hb San Francisco (Pacific), Hb Ube-1) | Hb Köln | HBB:c.295G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71019 |
2413 | CD 98 GTG>CTG [Val>Leu] | Hb Phou Bia | HBB:c.295G>C | β | Causative | β-chain variant | NG_000007.3 | 71019 |
2966 | CD 98/99 (+TG) | Hb Patagonia | HBB:c.296_297dup | β | Causative | β-chain variant | NG_000007.3 | 71020 |
1132 | CD 98 GTG>GGG | Hb Nottingham | HBB:c.296T>G | β | Causative | β-chain variant | NG_000007.3 | 71020 |
1133 | CD 98 GTG>GAG [Val>Glu] | Hb Mainz | HBB:c.296T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71020 |
1134 | CD 98 GTG>GCG | Hb Djelfa | HBB:c.296T>C | β | Causative | β-chain variant | NG_000007.3 | 71020 |
1135 | CD 99 GAT>TAT | Hb Ypsilanti | HBB:c.298G>T | β | Causative | β-chain variant | NG_000007.3 | 71022 |
1136 | CD 99 GAT>CAT | Hb Yakima | HBB:c.298G>C | β | Causative | β-chain variant | NG_000007.3 | 71022 |
1137 | CD 99 GAT>AAT | Hb Kempsey | HBB:c.298G>A | β | Causative | β-chain variant | NG_000007.3 | 71022 |
1138 | CD 99 GAT>GGT | Hb Hotel-Dieu | HBB:c.299A>G | β | Causative | β-chain variant | NG_000007.3 | 71023 |
1139 | CD 99 GAT>GCT | Hb Radcliffe | HBB:c.299A>C | β | Causative | β-chain variant | NG_000007.3 | 71023 |
1140 | CD 99 GAT>GTT | Hb Chemilly | HBB:c.299A>T | β | Causative | β-chain variant | NG_000007.3 | 71023 |
1141 | CD 99 GAT>GAA [Asp>Glu] | Hb Coimbra | HBB:c.300T>A | β | Causative | β-chain variant | NG_000007.3 | 71024 |
198 | CD 100 (-CC,+TCTGAGAACTT) >158aa | N/A | HBB:c.301_302delCCinsTCTGAGAACTT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71025 |
1142 | CD 100 CCT>GCT [Pro>Ala] | Hb Nice | HBB:c.301C>G | β | Causative | β-chain variant | NG_000007.3 | 71025 |
2399 | CD 100 CCT>ACT [Pro>Thr] | Hb Bellevue II | HBB:c.301C>A | β | Causative | β-chain variant | NG_000007.3 | 71025 |
2412 | CD 100 CCT>TCT [Pro>Ser] | Hb Niort | HBB:c.301C>T | β | Causative | β-chain variant | NG_000007.3 | 71025 |
1143 | CD 100 CCT>CGT | Hb New Mexico | HBB:c.302C>G | β | Causative | β-chain variant | NG_000007.3 | 71026 |
1144 | CD 100 CCT>CTT | Hb Brigham | HBB:c.302C>T | β | Causative | β-chain variant | NG_000007.3 | 71026 |
1145 | CD 101 GAG>CAG | Hb Rush | HBB:c.304G>C | β | Causative | β-chain variant | NG_000007.3 | 71028 |
1146 | CD 101 GAG>AAG | Hb British Columbia | HBB:c.304G>A | β | Causative | β-chain variant | NG_000007.3 | 71028 |
1147 | CD 101 GAG>GGG | Hb Alberta | HBB:c.305A>G | β | Causative | β-chain variant | NG_000007.3 | 71029 |
1148 | CD 101 GAG>GCG | Hb Youngstown | Hb St Mary's | HBB:c.305A>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71029 |
2432 | CD 101 GAG>GTG [Glu>Val] | Hb Belfort | HBB:c.305A>T | β | Causative | β-chain variant | NG_000007.3 | 71029 |
1149 | CD 101 GAG>GAC or GAT | Hb Potomac | HBB:c.306G>C | HBB:c.306G>T | β | Causative | β-chain variant | NG_000007.3 | 71030 |
1150 | CD 102 AAC>TAC | Hb Saint Mandé | HBB:c.307A>T | β | Causative | β-chain variant | NG_000007.3 | 71031 |
1151 | CD 102 AAC>CAC [Asn>His] | Hb Canebiere | HBB:c.307A>C | β | Causative | β-chain variant | NG_000007.3 | 71031 |
1152 | CD 102 AAC>AGC | Hb Beth Israel | HBB:c.308A>G | β | Causative | β-chain variant | NG_000007.3 | 71032 |
1153 | CD 102 AAC>ACC [Asn>Thr] (Hb Reissmann) | Hb Kansas | HBB:c.308A>C | β | Causative | β-chain variant | NG_000007.3 | 71032 |
2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
1154 | CD 102 AAC>AAA or AAG | Hb Richmond | HBB:c.309C>A | HBB:c.309C>G | β | Causative | β-chain variant | NG_000007.3 | 71033 |
1155 | CD 103 TTC>GTC | Hb Sparta | HBB:c.310T>G | β | Causative | β-chain variant | NG_000007.3 | 71034 |
1156 | CD 103 TTC>ATC | Hb Saint Nazaire | HBB:c.310T>A | β | Causative | β-chain variant | NG_000007.3 | 71034 |
3385 | CD 103 TTC>TAC [Phe>Tyr] | Hb Gavle | HBB:c.311T>A | β | Causative | β-chain variant | NG_000007.3 | 71035 |
1157 | CD 103 TTC>TTG | Hb Heathrow | HBB:c.312C>G | β | Causative | β-chain variant | NG_000007.3 | 71036 |
1158 | CD 104 AGG>TGG | Hb Sainte Eugénie | HBB:c.313A>T | β | Causative | β-chain variant | NG_000007.3 | 71037 |
2406 | CD 104 AGG>GGG [Arg>Gly] | Hb Nîmes | HBB:c.313A>G | β | Causative | β-chain variant | NG_000007.3 | 71037 |
3636 | CD 104 (-A) | N/A | HBB:c.313delA | β | Causative | β-thalassaemia | NG_000007.3 | 71037 |
2411 | CD 104 AGG>ATG [Arg>Met] | Hb Bad Salzuflen | HBB:c.314G>T | β | Causative | β-chain variant | NG_000007.3 | 71038 |
1159 | CD 104 AGG>ACG | Hb Sherwood Forest | HBB:c.314G>C | β | Causative | β-chain variant | NG_000007.3 | 71038 |
1161 | CD 104 AGG>AAG | Hb Alzette | HBB:c.314G>A | β | Causative | β-chain variant | NG_000007.3 | 71038 |
1162 | CD 104 AGG>AGC [Arg>Ser] | Hb Camperdown | HBB:c.315G>C | β | Causative | β-chain variant | NG_000007.3 | 71039 |
199 | IVS II-1 (-G) | N/A | HBB:c.315+1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
200 | IVS II-1 G>A | N/A | HBB:c.315+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
201 | IVS II-1 G>C | N/A | HBB:c.315+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
202 | IVS II-1 G>T | N/A | HBB:c.315+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
2182 | IVS II-2 -TGAGTCTATGGG | N/A | HBB:c.315+2_315+13delTGAGTCTATGGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
3226 | IVS II-2 T>G | N/A | HBB:c.315+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
203 | IVS II-2 T>C | N/A | HBB:c.315+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
204 | IVS II-2 (T>A) | N/A | HBB:c.315+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
206 | IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2)) | N/A | HBB:c.315+2_315+3delinsACGTTCTCTGA | β | Causative | β-thalassaemia | NG_000007.3 | 71041 |
207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
208 | IVS II-5 (G>C) | N/A | HBB:c.315+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71044 |
3677 | IVS II-15 (C>T) | N/A | HBB:c.315+15C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71054 |
3576 | rs10768683 (IVS II-16 G>C, HBB:c.315+16G>C) | N/A | NG_000007.3:g.71055G>C | β | Neutral | N/A | NG_000007.3 | 71055 |
3775 | IVS II-26 (T>G) | N/A | HBB:c.315+26T>G | β | Neutral | N/A | NG_000007.3 | 71065 |
2053 | IVS II-26 T>G | N/A | NG_000007.3:g.71065T>G | β | Neutral | N/A | NG_000007.3 | 71065 |
3678 | IVS II-45 (A>G) | N/A | HBB:c.315+45A>G | β | Causative | β-thalassaemia | NG_000007.3 | 71084 |
3681 | IVS II-63 (T>C) | N/A | HBB:c.315+63T>C | β | Causative | β-thalassaemia | NG_000007.3 | 71102 |
3680 | IVS II-70 (G>A) | N/A | HBB:c.315+70G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71109 |
3774 | IVS II-70 (G>C) | N/A | HBB:c.315+70G>C | β | Neutral | N/A | NG_000007.3 | 71109 |
2054 | IVS II-74 T>G | N/A | HBB:c.315+74T>G | β | Neutral | N/A | NG_000007.3 | 71113 |
3011 | IVS II-81 (C>T) | N/A | HBB:c.315+81C>T | β | Neutral | N/A | NG_000007.3 | 71120 |
3679 | IVS II-129 (G>A) | N/A | HBB:c.315+129G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71168 |
3977 | IVS II-132 G>C | N/A | HBB:c.315+132G>C | β | Causative | β-thalassaemia | NG_000007.3 | 71171 |
4040 | IVS II-143 G>A | N/A | HBB:c.315+143G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71182 |
3633 | IVS II-144 T>A | N/A | HBB:c.315+144T>A | β | Neutral | N/A | NG_000007.3 | 71183 |
3682 | IVS II-180 (T>C) | N/A | HBB:c.315+180T>C | β | Causative | β-thalassaemia | NG_000007.3 | 71219 |
3634 | IVS II-202 T>A | N/A | HBB:c.315+202T>A | β | Neutral | N/A | NG_000007.3 | 71241 |
3247 | IVS II-209 (-TTTT) | N/A | HBB:c.315+209_315+212delTTTT | β | Neutral | N/A | NG_000007.3 | 71248 |
3012 | IVS II-255 T>C | N/A | HBB:c.315+255T>C | β | Neutral | N/A | NG_000007.3 | 71294 |
2055 | IVS II-260 A>G | N/A | NG_000007.3:g.71299A>G | β | Neutral | N/A | NG_000007.3 | 71299 |
3683 | IVS II-308 (-A) | N/A | HBB:c.315+308delA | β | Causative | β-thalassaemia | NG_000007.3 | 71347 |
4046 | IVS II-337 A>G | N/A | HBB:c.315+337A>G | β | Causative | β-thalassaemia | NG_000007.3 | 71376 |
3996 | 4.9 Kb deletion (NG_000007.3:g.71429_76331del) | N/A | NC_000011.10:g.5226187_5231089del | β | Causative | β-thalassaemia, Ineffective erythropoiesis | NG_000007.3 | 71429 |
2495 | IVS II-478 C>A | N/A | HBB:c.316-373C>A | β | Neutral | N/A | NG_000007.3 | 71517 |
3797 | IVS II-509 (-A) | N/A | HBB:c.316-342delA | β | Causative | β-thalassaemia | NG_000007.3 | 71548 |
209 | IVS II-535 - CD 108 (+23, -310, +28) | Hb Jambol | HBB:c.[316-300_327delinsCAGGTGCCATCTGTCACCCTTTTCTTTG;316-316_316-315insAATATATTTTTAATATACTTTTT] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71590 |
286 | 619 bp deletion (Asian Indian) | N/A | NG_000007.3:g.71609_72227del619 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71609 |
3446 | IVS II-579 G>T | N/A | HBB:c.316-272G>T | β | Neutral | N/A | NG_000007.3 | 71618 |
3582 | IVS II-579 G>C | N/A | HBB:c.316-272G>C | β | Neutral | N/A | NG_000007.3 | 71618 |
210 | IVS II-613 (C>T) | N/A | HBB:c.316-238C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71652 |
3013 | IVS II-643 (C>G) | N/A | HBB:c.316-208C>G | β | Neutral | N/A | NG_000007.3 | 71682 |
3391 | IVS II-648/649 (-T) | N/A | HBB:c.316-202del | β | Causative | β-thalassaemia | NG_000007.3 | 71688 |
211 | IVS II-654 C>T | N/A | HBB:c.316-197C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71693 |
3866 | IVS II-659_664 (-GCAATA) | N/A | HBB:c.316-192_187del | β | Causative | β-thalassaemia | NG_000007.3 | 71698 |
2056 | IVS II-666 (C>T) | N/A | HBB:c.316-185C>T | β | Neutral | N/A | NG_000007.3 | 71705 |
3773 | IVS II-667 (T>C) | N/A | HBB:c.316-184T>C | β | Neutral | N/A | NG_000007.3 | 71706 |
3686 | IVS II-672 (A>C) | N/A | HBB:c.316-179A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71711 |
212 | IVS II-705 (T>G) | N/A | HBB:c.316-146T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71744 |
3796 | IVS II-716 (+T) | N/A | HBB:c.316-135dupT | β | Causative | β-thalassaemia | NG_000007.3 | 71755 |
213 | IVS II-726 A>G | N/A | HBB:c.316-125A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71765 |
214 | IVS II-745 C>G | N/A | HBB:c.316-106C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71784 |
3928 | IVS II-752 T>G | N/A | HBB:c.316-99T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71791 |
2200 | IVS II-765 L1 insertion (+CTGCTTTTATTTT) | N/A | HBB:c.316-98_316-86dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71792 |
215 | IVS II-761 A>G | N/A | HBB:c.316-90A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71800 |
2183 | IVS II-781 C>G | N/A | HBB:c.316-70C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71820 |
4088 | IVS II-786 T>A | N/A | HBB:c.316-65T>A | β | Causative | β-thalassaemia | NG_000007.3 | 71825 |
3687 | IVS II-806 (G>C) | N/A | HBB:c.316-45G>C | β | Causative | β-thalassaemia | NG_000007.3 | 71845 |
3616 | IVS II-809 (-G) | N/A | HBB:c.316-42delG | β | Causative | β-thalassaemia | NG_000007.3 | 71848 |
3772 | IVS II-814 (G>T) | N/A | HBB:c.316-37G>T | β | Neutral | N/A | NG_000007.3 | 71853 |
216 | IVS II-815 (C>T) | N/A | HBB:c.316-36C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71854 |
3558 | IVS II-821 (A>C) | N/A | HBB:c.316-30A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71860 |
217 | IVS II-837 (T>G) | N/A | HBB:c.316-14T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71876 |
218 | IVS II-843 (T>G) | N/A | HBB:c.316-8T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71882 |
219 | IVS II-844 (C>A) | N/A | HBB:c.316-7C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
220 | IVS II-844 (C>G) | N/A | HBB:c.316-7C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
221 | IVS II-848 (C>A) | N/A | HBB:c.316-3C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
222 | IVS II-848 (C>G) | N/A | HBB:c.316-3C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
3045 | IVS II-848 C>T | N/A | HBB: c.316-3C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71887 |
223 | IVS II-849 (A>G) | N/A | HBB:c.316-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
224 | IVS II-849 (A>C) | N/A | HBB:c.316-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
225 | IVS II-850 G>C | N/A | HBB:c.316-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
226 | IVS II-850 (G>A) | N/A | HBB:c.316-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
227 | IVS II-850 (G>T) | N/A | HBB:c.316-1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
1163 | CD 105 CTC>TTC | Hb South Milwaukee | HBB:c.316C>T | β | Causative | β-chain variant | NG_000007.3 | 71890 |
4100 | CD 105 CTC>GTC [Leu>Val] | Hb Odder | HBB:c.316C>G | β | Causative | β-chain variant | NG_000007.3 | 71890 |
2379 | CD 6 GAG>GTG [Glu>Val] AND CD 105 CTC>CCC [Leu>Pro] | Hb S-San Martin | HBB:c.[20A>T ;317T>C] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71891 |
2404 | CD 105 CTC>CCC [Leu>Pro] | Hb Bellevue IV | HBB:c.317T>C | β | Causative | β-chain variant | NG_000007.3 | 71891 |
229 | CD 106 (CTG >GTG) Leu to Val (Hb Federico II) | Hb L'Aquila | HBB:c.319C>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71893 |
230 | CD 106 CTG>CGG [Leu>Arg] | Hb Terre Haute | HBB:c.320T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71894 |
1166 | CD 106 CTG>CCG [Leu>Pro] (Hb Casper) | Hb Southampton | HBB:c.320T>C | β | Causative | β-chain variant | NG_000007.3 | 71894 |
1167 | CD 106 CTG>CAG | Hb Tübingen | HBB:c.320T>A | β | Causative | β-chain variant | NG_000007.3 | 71894 |
1168 | CD 107 GGC>CGC | Hb Burke | HBB:c.322G>C | β | Causative | β-chain variant | NG_000007.3 | 71896 |
231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
1169 | CD 107 GGC>GAC | Hb Lulu Island | HBB:c.323G>A | β | Causative | β-chain variant | NG_000007.3 | 71897 |
2191 | CD 107-111 (-12 bp): (-GCAACGTGCTGG) | N/A | HBB:c.323_334del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
3309 | CD 107 GGC>GTC [Gly>Val] | Hb Nurnberg | HBB:c.323G>T | β | Causative | β-chain variant | NG_000007.3 | 71897 |
1170 | CD 108 AAC>GAC | Hb Yoshizuka | HBB:c.325A>G | β | Causative | β-chain variant | NG_000007.3 | 71899 |
1171 | CD 108 AAC>CAC [Asn>His] | Hb Shizuoka | HBB:c.325A>C | β | Causative | β-chain variant | NG_000007.3 | 71899 |
232 | CD 108-112 (-12 bp) Asn-Val-Leu-Val-Cys to Ser | N/A | HBB:c.326_337delACGTGCTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71900 |
1172 | CD 108 AAC>ATC | Hb Schlierbach | HBB:c.326A>T | β | Causative | β-chain variant | NG_000007.3 | 71900 |
1173 | CD 108 AAC>AGC [Asn>Ser] (Hb Serres) | Hb Santa Juana | HBB:c.326A>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71900 |
1174 | CD 108 AAC>AAA or AAG | Hb Presbyterian | HBB:c.327C>A | HBB:c.327C>G | β | Causative | β-chain variant | NG_000007.3 | 71901 |
233 | CD 109 (-G) >156aa | Hb Manhattan | HBB:c.328delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71902 |
1176 | CD 109 GTG>CTG or TTG | Hb Johnstown | HBB:c.328G>C | HBB:c.328G>T | β | Causative | β-chain variant | NG_000007.3 | 71902 |
1177 | CD 109 GTG>ATG | Hb San Diego | HBB:c.328G>A | β | Causative | β-chain variant | NG_000007.3 | 71902 |
4064 | CD109/110 (-GCT +CAGCACGATG) | N/A | HBB:c.330_332delinsCAGCACGATG | β | Causative | β-thalassaemia | NG_000007.3 | 71904 |
3384 | CD 110 CTG>CGG [Leu>Arg] | Hb London-Ontario | HBB:c.332T>G | β | Causative | β-chain variant | NG_000007.3 | 71906 |
234 | CD 110 CTG>CCG [Leu>Pro] | Hb Showa-Yakushiji | HBB:c.332T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71906 |
1179 | CD 111 GTC>CTC, CD 119 GGC>GAC | Hb Fannin-Lubbock II | HBB:c.[334G>C;359G>A] | β | Causative | β-chain variant | NG_000007.3 | 71908 |
1180 | CD 111 GTC>TTC [Val>Phe] | Hb Peterborough | HBB:c.334G>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71908 |
1181 | CD 111 GTC>GCC [Val>Ala] | Hb Stanmore | HBB:c.335T>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71909 |
3001 | CD 111 GTC>GGC [Val>Gly] | Hb Belluno | HBB:c.335T>G | β | Causative | β-chain variant | NG_000007.3 | 71909 |
3024 | CD 111-115 (-12bp): (-TCTGTGTGCTGG) | N/A | HBB:c.335_346del | β | Causative | β-thalassaemia | NG_000007.3 | 71909 |
4075 | CD 111/112 (+C) | N/A | HBB:c.336dup | β | Causative | β-thalassaemia | NG_000007.3 | 71910 |
2434 | CD 112 TGT>GGT [Cys>Gly] | Hb Saint-Marcellin | HBB:c.337T>G | β | Causative | β-chain variant | NG_000007.3 | 71911 |
1182 | CD 112 TGT>CGT [Cys>Arg] | Hb Indianapolis | HBB:c.337T>C | β | Causative | β-chain variant | NG_000007.3 | 71911 |
1183 | CD 112 TGT>TTT | Hb Canterbury | HBB:c.338G>T | β | Causative | β-chain variant | NG_000007.3 | 71912 |
1184 | CD 112 TGT>TAT | Hb Yahata | HBB:c.338G>A | β | Causative | β-chain variant | NG_000007.3 | 71912 |
1195 | CD 112-116 (+GTGTGCTGGCCC) | Hb Antibes-Juan-Les-Pins | HBB:c.338_349dupGTGTGCTGGCCC | β | Causative | β-chain variant | NG_000007.3 | 71912 |
4105 | CD112 TGT>TCT [Cys>Ser] | Hb Jiangxi | HBB:c.338G>C | β | Causative | β-chain variant | NG_000007.3 | 71912 |
2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
235 | CD 112 (TGT>TGA) | N/A | HBB:c.339T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
1185 | CD 112 TGT>TGG | Hb Toranomon | HBB:c.339T>G | β | Causative | β-chain variant | NG_000007.3 | 71913 |
236 | CD 113 (-G) >156aa | N/A | HBB:c.340delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71914 |
1186 | CD 113 GTG>CTG or TTG [Val>Leu] | Hb Champagne | HBB:c.340G>C | HBB:c.340G>T | β | Causative | β-chain variant | NG_000007.3 | 71914 |
1187 | CD 113 GTG>GAG [Val>Glu] (Hb Kaohsiung) | Hb New York | HBB:c.341T>A | β | Causative | β-chain variant | NG_000007.3 | 71915 |
238 | CD 114 (-CT, +G) >156aa | Hb Geneva | HBB:c.343_344delinsG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71917 |
1188 | CD 114 CTG>ATG; CD 119 GGC>GAC | Hb Masuda | HBB:c.[343C>A;359G>A] | β | Causative | β-chain variant | NG_000007.3 | 71917 |
1190 | CD 114 CTG>ATG | Hb Zengcheng | HBB:c.343C>A | β | Causative | β-chain variant | NG_000007.3 | 71917 |
237 | CD 114 CTG>CCG [Leu>Pro] (Hb Brescia) | Hb Durham-N.C. | HBB:c.344T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71918 |
1192 | CD 115 GCC>CCC | Hb Madrid | HBB:c.346G>C | β | Causative | β-chain variant | NG_000007.3 | 71920 |
3750 | CD 115 GCC>ACC [Ala>Thr] | N/A | HBB:c.346G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71920 |
239 | CD 115 (GCC>GAC) Ala to Asp | Hb Hradec Kralove (HK) | HBB:c.347C>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71921 |
1193 | CD 115 GCC>GTC [Ala>Val] | Hb Roma | HBB:c.347C>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71921 |
3308 | CD 115-116 (-CC, +G) >156aa | Hb Grand Junction | HBB:c.348_349delinsG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71922 |
3228 | CD 116 CAT>-AT | N/A | HBB:c.349del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71923 |
1196 | CD 116 CAT>TAT | Hb Rhode Island | HBB:c.349C>T | β | Causative | β-chain variant | NG_000007.3 | 71923 |
240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
1197 | CD 116 CAT>CCT [His>Pro] | Hb Miami | HBB:c.350A>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71924 |
1198 | CD 116 CAT>CGT [His>Ala] | Hb Sfax | HBB:c.350A>G | β | Causative | β-chain variant | NG_000007.3 | 71924 |
1199 | CD 116 CAT>CTT | Hb Vexin | HBB:c.350A>T | β | Causative | β-chain variant | NG_000007.3 | 71924 |
1200 | CD 116 CAT>CAA or CAG | Hb Hafnia | HBB:c.351T>A | HBB:c.351T>G | β | Causative | β-chain variant | NG_000007.3 | 71925 |
1201 | CD 117 CAC>AAC | Hb Brent | HBB:c.352C>A | β | Causative | β-chain variant | NG_000007.3 | 71926 |
1202 | CD 117 CAC>TAC | Hb Tsukumi | HBB:c.352C>T | β | Causative | β-chain variant | NG_000007.3 | 71926 |
1203 | CD 117 CAC>GAC [His>Asp] | Hb North York | HBB:c.352C>G | β | Causative | β-chain variant | NG_000007.3 | 71926 |
1204 | CD 117 CAC>CGC | Hb P-Galveston | HBB:c.353A>G | β | Causative | β-chain variant | NG_000007.3 | 71927 |
1205 | CD 117 CAC>CCC | Hb Saitama | HBB:c.353A>C | β | Causative | β-chain variant | NG_000007.3 | 71927 |
2193 | CD 117 -C | N/A | HBB:c.354delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71928 |
3651 | CD 117 CAC>CAG [His>Gln] | Hb Murcia | HBB:c.354C>G | β | Causative | β-chain variant | NG_000007.3 | 71928 |
1207 | CD 118 TTT>GTT | Hb Sodertalje | HBB:c.355T>G | β | Causative | β-chain variant | NG_000007.3 | 71929 |
1208 | CD 118 TTT>TGT | Hb Harrow | HBB:c.356T>G | β | Causative | β-chain variant | NG_000007.3 | 71930 |
1209 | CD 118 TTT>TAT | Hb Minneapolis-Laos | HBB:c.356T>A | β | Causative | β-chain variant | NG_000007.3 | 71930 |
2334 | CD 118 TTT>TCT [Phe>Ser] | Hb Basingstoke | HBB:c.356T>C | β | Causative | β-chain variant | NG_000007.3 | 71930 |
3846 | CD 118 (-TT) | N/A | HBB:c.356_357delTT | β | Causative | β-thalassaemia | NG_000007.3 | 71930 |
241 | CD 118 (-T) > 156aa | Hb Sainte Seve | HBB:c.357delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71931 |
2410 | CD 119 GGC>CGC [Gly>Arg] | Hb Angouleme | HBB:c.358G>C | β | Causative | β-chain variant | NG_000007.3 | 71932 |
2490 | CD 119 GGC>AGC [Gly>Ser] | Hb Madison-NC | HBB:c.358G>A | β | Causative | β-chain variant | NG_000007.3 | 71932 |
1210 | CD 119 GGC>GAC [Gly>Asp] | Hb Fannin-Lubbock I | HBB:c.359G>A | β | Causative | β-chain variant | NG_000007.3 | 71933 |
1211 | CD 119 GGC>GTC | Hb Bougardirey-Mali | HBB:c.359G>T | β | Causative | β-chain variant | NG_000007.3 | 71933 |
1212 | CD 119 GGC>GCC | Hb Iowa | HBB:c.359G>C | β | Causative | β-chain variant | NG_000007.3 | 71933 |
1213 | CD 120 AAA>GAA | Hb Hijiyama | HBB:c.361A>G | β | Causative | β-chain variant | NG_000007.3 | 71935 |
1214 | CD 120 AAA>CAA | Hb Takamatsu | HBB:c.361A>C | β | Causative | β-chain variant | NG_000007.3 | 71935 |
1215 | CD 120 AAA>ATA | Hb Jianghua | HBB:c.362A>T | β | Causative | β-chain variant | NG_000007.3 | 71936 |
242 | CD 120 -A [156 aa] (CD 120 AAA>AA-) | Hb Filottrano | HBB:c.363delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
243 | CD 120/121 (+A) | N/A | HBB:c.363dupA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
1216 | CD 120 AAA>AAC | Hb Riyadh | HBB:c.363A>C | β | Causative | β-chain variant | NG_000007.3 | 71937 |
2973 | CD 120 AAA>AAT [Lys>Asn] | Hb Belsize Park | HBB:c.363A>T | β | Causative | β-chain variant | NG_000007.3 | 71937 |
244 | CD 121 GAA>TAA (120aa) | N/A | HBB:c.364G>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71938 |
1217 | CD 121 GAA>CAA [Glu>Gln] (Hb D-Chicago, Hb D-North Carolina, Hb D-Portugal, Hb D-Los Angeles, Hb Oak Ridge) | Hb D-Punjab | HBB:c.364G>C | β | Causative | β-chain variant | NG_000007.3 | 71938 |
1218 | CD 121 GAA>AAA (Hb Egypt, Hb O-Thrace) | Hb O-Arab | HBB:c.364G>A | β | Causative | β-chain variant | NG_000007.3 | 71938 |
1219 | CD 121 GAA>GCA | Hb D-Neath | HBB:c.365A>C | β | Causative | β-chain variant | NG_000007.3 | 71939 |
1220 | CD 121 GAA>GGA | Hb St. Francis | HBB:c.365A>G | β | Causative | β-chain variant | NG_000007.3 | 71939 |
1221 | CD 121 GAA>GTA | Hb Beograd | HBB:c.365A>T | β | Causative | β-chain variant | NG_000007.3 | 71939 |
3934 | CD 121 GAA>GAC [Glu>Asp] | Hb Westport | HBB:c.366A>C | β | Causative | β-chain variant | NG_000007.3 | 71940 |
1015 | CD 65 AAG>ATG; CD 122 TTC>CTC or TTG or TTA | Hb Casablanca | HBB:c.[367T>C ; 197A>T] | HBB:c.[369C>A ; 197A>T] | HBB:c.[369C>G; 197A>T] | β | Causative | β-chain variant | NG_000007.3 | 71941 |
1222 | CD 122 TTC>CTC or TTG or TTA | Hb Bushey | HBB:c.367T>C | HBB:c.369C>A | HBB:c.369C>G | β | Causative | β-chain variant | NG_000007.3 | 71941 |
1223 | CD 122 TTC>TCC [Phe>Ser] | Hb Caruaru | HBB:c.368T>C | β | Causative | β-chain variant | NG_000007.3 | 71942 |
4022 | CD 122 TTC>TGC [Phe>Cys] | Hb Tanah Merah | HBB:c.368T>G | β | Causative | β-chain variant | NG_000007.3 | 71942 |
2058 | CD 122 TTT>TTC [Phe>Phe] | N/A | NG_000007.3:g.71943C>T | β | Neutral | N/A | NG_000007.3 | 71943 |
245 | CD 123 (-A) >156aa | Hb Makabe | HBB:c.370delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
246 | CD 123-125 (-ACCCCACC) >135aa | Hb Khon Kaen | HBB:c.370_378delACCCCACCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
1225 | CD 123 ACC>AAC | Hb Ernz | HBB:c.371C>A | β | Causative | β-chain variant | NG_000007.3 | 71945 |
1226 | CD 123 ACC>ATC | Hb Villejuif | HBB:c.371C>T | β | Causative | β-chain variant | NG_000007.3 | 71945 |
1227 | CD 124 CCA>TCA | Hb Tunis | HBB:c.373C>T | β | Causative | β-chain variant | NG_000007.3 | 71947 |
3556 | CD 124 CCA>ACA [Pro>Thr] (Hb Yuxi) | Hb Gibbon | HBB:c.373C>A | β | Causative | β-chain variant | NG_000007.3 | 71947 |
3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
4065 | CD 124 (-C) | N/A | HBB:c.374delC | β | Causative | α-thalassaemia | NG_000007.3 | 71948 |
1228 | CD 124 CCA>CAA | Hb Ty Gard | HBB:c.374C>A | β | Causative | β-chain variant | NG_000007.3 | 71948 |
1229 | CD 124 CCA>CTA | Hb Tende | HBB:c.374C>T | β | Causative | β-chain variant | NG_000007.3 | 71948 |
1230 | CD 124 CCA>CGA [Pro>Arg] | Hb Khartoum | HBB:c.374C>G | β | Causative | β-chain variant | NG_000007.3 | 71948 |
247 | CD 124 (-A) >156aa | N/A | HBB:c.375delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
3227 | CD 125-126 (+CCAGT) | N/A | HBB:c.376_380dupCCAGT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
3313 | CD 125 CCA>ACA [Pro>Thr] | Hb Novara | HBB:c.376C>A | β | Causative | β-chain variant | NG_000007.3 | 71950 |
248 | CD 125 (+CCA) | N/A | HBB:c.376_378dupCCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
249 | CD 125 (-A) >156aa | N/A | HBB:c.378delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71952 |
1231 | CD 126 GTG>CTG | Hb Molfetta | HBB:c.379G>C | β | Causative | β-chain variant | NG_000007.3 | 71953 |
3563 | CD 126 GTG>-TG | N/A | HBB:c.379delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71953 |
250 | CD 126 (-T) >156aa | Hb Vercelli | HBB:c.380delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
252 | CD 126-131 (-17 bp) | Hb Westdale | HBB:c.380_396delTGCAGGCTGCCTATCAG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71954 |
1233 | CD 126 GTG>GCG | Hb Beirut | HBB:c.380T>C | β | Causative | β-chain variant | NG_000007.3 | 71954 |
1234 | CD 126 GTG>GAG | Hb Hofu | HBB:c.380T>A | β | Causative | β-chain variant | NG_000007.3 | 71954 |
1235 | CD 126 GTG>GGG [Val>Gly] (Hb Neapolis) | Hb Dhonburi | HBB:c.380T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
255 | CD 127 CAG>TAG [Gln>STOP] | N/A | HBB:c.382C>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71956 |
1236 | CD 127 CAG>AAG | Hb Brest | HBB:c.382C>A | β | Causative | β-chain variant | NG_000007.3 | 71956 |
1237 | CD 127 CAG>GAG | Hb Complutense | HBB:c.382C>G | β | Causative | β-chain variant | NG_000007.3 | 71956 |
4087 | CD 128-134 (-21bp): (-CAGGCTGCCTATCAGAAAGTG) | N/A | HBB:c.382_402del | β | Causative | β-thalassaemia | NG_000007.3 | 71956 |
253 | CD 127 (CAG>CCG) Gln to Pro | Hb Houston | HBB:c.383A>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
254 | CD 127 CAG>CGG [Gln>Arg] | Hb Dieppe | HBB:c.383A>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
256 | CD 127/128 -AGG [Glu-Ala>Pro] | Hb Gunma | HBB:c.383_385delAGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
257 | CD 128/129 (-4, +5, -11 bp) >153aa | N/A | HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
1241 | CD 128 GCT>CCT | Hb Mont Saint Aignan | HBB:c.385G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
3927 | CD 128 GCT>-CT | N/A | HBB:c.385delG | β | Causative | β-thalassaemia | NG_000007.3 | 71959 |
1242 | CD 128 GCT>GTT | Hb Sitia | HBB:c.386C>T | β | Causative | β-chain variant | NG_000007.3 | 71960 |
1243 | CD 128 GCT>GAT [Ala>Asp] | Hb J-Guantanamo | HBB:c.386C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71960 |
1244 | CD 129 GCC>CCC | Hb Crete | HBB:c.388G>C | β | Causative | β-chain variant | NG_000007.3 | 71962 |
1245 | CD 129 GCC>GTC [Ala>Val] | Hb La Desirade | HBB:c.389C>T | β | Causative | β-chain variant | NG_000007.3 | 71963 |
1246 | CD 129 GCC>GAC [Ala>Asp] (Hb K-Cameroon) | Hb J-Taichung | HBB:c.389C>A | β | Causative | β-chain variant | NG_000007.3 | 71963 |
3951 | CD 129-133 (-CCTATCAGAAAGT) | Hb Phoenix | HBB:c.389_401del | β | Causative | β-chain variant | NG_000007.3 | 71963 |
1248 | CD 130 TAT>GAT | Hb Wien | HBB:c.391T>G | β | Causative | β-chain variant | NG_000007.3 | 71965 |
1249 | CD 130 TAT>TGT [Tyr>Cys] | Hb Montfermeil | HBB:c.392A>G | β | Causative | β-chain variant | NG_000007.3 | 71966 |
1250 | CD 130 TAT>TCT | Hb Nevers | HBB:c.392A>C | β | Causative | β-chain variant | NG_000007.3 | 71966 |
2196 | CD 130 TAT>TAA [Tyr>STOP] | N/A | HBB:c.393T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71967 |
3860 | CD 130 TAT>TAG [Tyr>STOP] | N/A | HBB:c.393T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71967 |
258 | CD 131 (CAG>TAG) | N/A | HBB:c.394C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71968 |
1251 | CD 131 CAG>GAG | Hb Camden | HBB:c.394C>G | β | Causative | β-chain variant | NG_000007.3 | 71968 |
1252 | CD 131 CAG>AAG | Hb Shelby | HBB:c.394C>A | β | Causative | β-chain variant | NG_000007.3 | 71968 |
1253 | CD 131 CAG>CGG | Hb Sarrebourg | HBB:c.395A>G | β | Causative | β-chain variant | NG_000007.3 | 71969 |
1254 | CD 131 CAG>CCG | Hb Shanghai | HBB:c.395A>C | β | Causative | β-chain variant | NG_000007.3 | 71969 |
2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
260 | CD 131-132 (-GA) >138aa | N/A | HBB:c.396_397delGA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
261 | CD 131-134 (-11bp) >134aa | N/A | HBB:c.396_406del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
1255 | CD 131 CAG>CAC | Hb Silver Springs | HBB:c.396G>C | β | Causative | β-chain variant | NG_000007.3 | 71970 |
262 | CD 132 (AAA>TAA) | N/A | HBB:c.397A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
1256 | CD 132 AAA>GAA [Lys>Glu] | Hb Takasago | HBB:c.397A>G | β | Causative | β-chain variant | NG_000007.3 | 71971 |
1257 | CD 132 AAA>CAA [Lys>Gln] | Hb K Woolwich | HBB:c.397A>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
1258 | CD 132 AAA>ACA | Hb Cook | HBB:c.398A>C | β | Causative | β-chain variant | NG_000007.3 | 71972 |
1259 | CD 132 AAA>AAC, also AAA>AAT | Hb Yamagata | HBB:c.399A>C | HBB:c.399A>T | β | Causative | β-chain variant | NG_000007.3 | 71973 |
3896 | CD 132 (AAA>AA-) | N/A | HBB:c.399del | β | Causative | β-thalassaemia | NG_000007.3 | 71973 |
3375 | CD 133 GTG>TTG [Val>Leu] | Hb Miringa | HBB:c.400G>T | β | Causative | β-chain variant | NG_000007.3 | 71974 |
1260 | CD 133 GTG>CTG | Hb Extremadura | HBB:c.400G>C | β | Causative | β-chain variant | NG_000007.3 | 71974 |
1261 | CD 133 GTG>ATG [Val>Met] | Hb La Pommeraie | HBB:c.400G>A | β | Causative | β-chain variant | NG_000007.3 | 71974 |
1262 | CD 133 GTG>GCG | Hb Renert | HBB:c.401T>C | β | Causative | β-chain variant | NG_000007.3 | 71975 |
3784 | CD 133 GTG>GTC [Val>Val] | N/A | HBB:c.402G>C | β | Neutral | N/A | NG_000007.3 | 71976 |
2389 | CD 134 GTG>GGG [Val>Gly] | Hb Olupona | HBB:c.404T>G | β | Causative | β-chain variant | NG_000007.3 | 71978 |
263 | CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg | N/A | HBB:c.404_413delinsGCAG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
1263 | CD 134 GTG>GCG | Hb Yaounde | HBB:c.404T>C | β | Causative | β-chain variant | NG_000007.3 | 71978 |
1264 | CD 134 GTG>GAG | Hb North Shore | HBB:c.404T>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
1265 | CD 135 GCT>CCT [Ala>Pro] | Hb Altdorf | HBB:c.406G>C | β | Causative | β-chain variant | NG_000007.3 | 71980 |
2537 | CD 135 GCT>ACT [Ala>Thr] | Hb Calvino | HBB:c.406G>A | β | Causative | β-chain variant | NG_000007.3 | 71980 |
1266 | CD 135 GCT>GAT [Ala>Asp] | Hb Beckman | HBB:c.407C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71981 |
1267 | CD 135 GCT>GTT [Ala>Val] | Hb Alperton | HBB:c.407C>T | β | Causative | β-chain variant | NG_000007.3 | 71981 |
3249 | CD 135 GCT>GC- | Hb Urumqi | HBB:c.408delT | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71982 |
1268 | CD 136 GGT>TGT [Gly>Cys] | Hb Visayan | HBB:c.409G>T | β | Causative | β-chain variant | NG_000007.3 | 71983 |
1269 | CD 136 GGT>AGT [Gly>Ser] | Hb Perpignan | HBB:c.409G>A | β | Causative | β-chain variant | NG_000007.3 | 71983 |
1270 | CD 136 GGT>CGT | Hb 'tlangeland | HBB:c.409G>C | β | Causative | β-chain variant | NG_000007.3 | 71983 |
1271 | CD 136 GGT>GCT [Gly>Ala] | Hb Petit Bourg | HBB:c.410G>C | β | Causative | β-chain variant | NG_000007.3 | 71984 |
1272 | CD 136 GGT>GAT | Hb Hope | HBB:c.410G>A | β | Causative | β-chain variant | NG_000007.3 | 71984 |
3847 | CD 136 GGT>GTT [Gly>Val] | Hb Bourg-en-Bresse | HBB:c.410G>T | β | Causative | β-chain variant | NG_000007.3 | 71984 |
3034 | CD 137 GTG>TGG [Val>Trp] | Hb Allentown | HBB:c.412_413delinsTG | β | Causative | β-chain variant | NG_000007.3 | 71986 |
264 | CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp | Hb Stara Zagora | HBB:c.413_418delTGGCTA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71987 |
1274 | CD 138 GCT>CCT [Ala>Pro] | Hb Brockton | HBB:c.415G>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71989 |
1275 | CD 138 GCT>ACT | Hb Buzen | HBB:c.415G>A | β | Causative | β-chain variant | NG_000007.3 | 71989 |
1276 | CD 138 GCT>GTT [Ala>Val] | Hb Cutlerville | HBB:c.416C>T | β | Causative | β-chain variant | NG_000007.3 | 71990 |
3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
2994 | CD 139 AAT>CAT [Asn>His] | Hb Bermondsey | HBB:c.418A>C | β | Causative | β-chain variant | NG_000007.3 | 71992 |
3370 | CD 140 GCC>ACC [Ala>Thr] AND CD 139 (-AAT) | Hb Templeuve | HBB:c.[421G>A;418_420delAAT] | β | Causative | β-chain variant | NG_000007.3 | 71992, 71995 |
1277 | CD 139 AAT>TAT | Hb Aurora | HBB:c.418A>T | β | Causative | β-chain variant | NG_000007.3 | 71992 |
1278 | CD 139 AAT>GAT | Hb Geelong | HBB:c.418A>G | β | Causative | β-chain variant | NG_000007.3 | 71992 |
1279 | CD 139 AAT>TAT [Asn>Tyr]; CD 138 (-GCT) [-Ala] (Hb Nykerk) | Hb Nijkerk | HBB:c.[418A>T;415_417delGCT] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71992 |
1280 | CD 139 AAT>ACT | Hb Sagami | HBB:c.419A>C | β | Causative | β-chain variant | NG_000007.3 | 71993 |
3388 | CD 139 AAT>AGT [Asn>Ser] | Hb Emilia | HBB:c.419A>G | β | Causative | β-chain variant | NG_000007.3 | 71993 |
2282 | CD 139/140 +T [163 aa] | Hb Boston-Kuwait | HBB:c.420dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71994 |
1281 | CD 139 AAT>AAR [Asn>Lys] | Hb Hinsdale | HBB:c.420T>R | β | Causative | β-chain variant | NG_000007.3 | 71994 |
2059 | CD 139 AAT>AAC [Asn>Asn] | N/A | NG_000007.3:g.71994T>C | β | Neutral | N/A | NG_000007.3 | 71994 |
1282 | CD 140 GCC>ACC | Hb Saint-Jacques | HBB:c.421G>A | β | Causative | β-chain variant | NG_000007.3 | 71995 |
1283 | CD 140 GCC>GAC [Ala>Asp] | Hb Himeji | HBB:c.422C>A | β | Causative | β-chain variant | NG_000007.3 | 71996 |
1284 | CD 140 GCC>GTC | Hb Puttelange | HBB:c.422C>T | β | Causative | β-chain variant | NG_000007.3 | 71996 |
265 | CD 141 (-C) >156aa | Hb Florida | HBB:c.424delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71998 |
1285 | CD 141 CTG>GTG; CD 144 AAG>TAG | Hb Kochi | HBB:c.[424C>G;433A>T] | β | Causative | β-chain variant | NG_000007.3 | 71998 |
1287 | CD 141 (-CTG) | Hb Coventry | HBB:c.424_426delCTG | β | Causative | β-chain variant | NG_000007.3 | 71998 |
2284 | CD 141 CTG>GGG | Hb Aurillac | HBB:c.424C>G | β | Causative | β-chain variant | NG_000007.3 | 71998 |
3980 | CD 141 CTG>CCG [Leu>Pro] | Hb Yoshkar-Ola | HBB:c.425T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia | NG_000007.3 | 71999 |
1288 | CD 141-144 (-TGGCCCACA) | Hb Birmingham | HBB:c.425_433delTGGCCCACA | β | Causative | β-chain variant | NG_000007.3 | 71999 |
1289 | CD 141 CTG>CGG | Hb Olmsted | HBB:c.425T>G | β | Causative | β-chain variant | NG_000007.3 | 71999 |
1291 | CD 142 GCC>ACC | Hb Inglewood | HBB:c.427G>A | β | Causative | β-chain variant | NG_000007.3 | 72001 |
1292 | CD 142 GCC>CCC | Hb Toyoake | HBB:c.427G>C | β | Causative | β-chain variant | NG_000007.3 | 72001 |
1293 | CD 142 GCC>GAC | Hb Ohio | HBB:c.428C>A | β | Causative | β-chain variant | NG_000007.3 | 72002 |
2297 | CD 142 GCC>GTC (Ala>Val) | Hb Waterland | HBB:c.428C>T | β | Causative | β-chain variant | NG_000007.3 | 72002 |
1290 | CD 142 (-CC) | Hb Uzes | HBB:c.429_430delCC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72003 |
1295 | CD 143 CAC>GAC | Hb Rancho Mirage | HBB:c.430C>G | β | Causative | β-chain variant | NG_000007.3 | 72004 |
1296 | CD 143 CAC>AAC [His>Asn] | Hb Sapporo | HBB:c.430C>A | β | Causative | β-chain variant | NG_000007.3 | 72004 |
1297 | CD 143 CAC>TAC | Hb Old Dominion/Burton-upon-Trent (OD/BuT) | HBB:c.430C>T | β | Causative | β-chain variant | NG_000007.3 | 72004 |
2024 | CD 143 (-C) | Hb Montreal II | HBB:c.430delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72004 |
1294 | CD 143 (-A) | Hb Saverne | HBB:c.431delA | β | Causative | β-chain variant | NG_000007.3 | 72005 |
1298 | CD 143 CAC>CTC [His>Leu] | Hb Vancleave | HBB:c.431A>T | β | Causative | β-chain variant | NG_000007.3 | 72005 |
1299 | CD 143 CAC>CGC | Hb Abruzzo | HBB:c.431A>G | β | Causative | β-chain variant | NG_000007.3 | 72005 |
1300 | CD 143 CAC>CCC | Hb Syracuse | HBB:c.431A>C | β | Causative | β-chain variant | NG_000007.3 | 72005 |
1301 | CD 143 CAC>CAA or CAG [His>Gln] | Hb Little Rock | HBB:c.432C>A | HBB:c.432C>G | β | Causative | β-chain variant | NG_000007.3 | 72006 |
3771 | CD 143 CAC>CAT [His>His] | N/A | HBB:c.432C>T | β | Neutral | N/A | NG_000007.3 | 72006 |
2364 | CD 144 AAG>TAG | Hb Cambridge-MA | HBB:c.433A>T | β | Causative | β-chain variant | NG_000007.3 | 72007 |
1303 | CD 144 AAG>GAG | Hb Mito | HBB:c.433A>G | β | Causative | β-chain variant | NG_000007.3 | 72007 |
1302 | CD 144 (-A) | Hb Trento | HBB:c.434delA | β | Causative | β-chain variant | NG_000007.3 | 72008 |
1304 | CD 144 AAG>ATG | Hb Barbizon | HBB:c.434A>T | β | Causative | β-chain variant | NG_000007.3 | 72008 |
2961 | CD 144 AAG>ACG [Lys>Thr] | Hb San Cataldo | HBB:c.434A>C | β | Causative | β-chain variant | NG_000007.3 | 72008 |
3325 | CD 144 AAG>AGG [Lys>Arg] | Hb Heze | HBB:c.434A>G | β | Causative | β-chain variant | NG_000007.3 | 72008 |
1305 | CD 144 AAG>AAT or AAC | Hb Andrew-Minneapolis | HBB:c.435G>C | HBB:c.435G>T | β | Causative | β-chain variant | NG_000007.3 | 72009 |
1306 | CD 145 (+CT) | Hb Cranston | HBB:c.436_437insCT | β | Causative | β-chain variant | NG_000007.3 | 72010 |
1307 | CD 145 TAT>AAT | Hb Osler | HBB:c.436T>A | β | Causative | β-chain variant | NG_000007.3 | 72010 |
1308 | CD 145 TAT>CAT | Hb Bethesda | HBB:c.436T>C | β | Causative | β-chain variant | NG_000007.3 | 72010 |
1309 | CD 145 TAT>GAT | Hb Nancy | HBB:c.436T>G | β | Causative | β-chain variant | NG_000007.3 | 72010 |
1310 | CD 145 TAT>TGT | Hb Rainier | HBB:c.437A>G | β | Causative | β-chain variant | NG_000007.3 | 72011 |
1311 | CD 145 TAT>TAA | Hb McKees Rocks | HBB:c.438T>A | β | Causative | β-chain variant | NG_000007.3 | 72012 |
1312 | CD 146 CAC>GAC | Hb Hiroshima | HBB:c.439C>G | β | Causative | β-chain variant | NG_000007.3 | 72013 |
1313 | CD 146 CAC>TAC | Hb Bologna-St.Orsola | HBB:c.439C>T | β | Causative | β-chain variant | NG_000007.3 | 72013 |
3398 | CD 146 CAC>AAC [His>Asn] | Hb Pusan | HBB:c.439C>A | β | Causative | β-chain variant | NG_000007.3 | 72013 |
1314 | CD 146 CAC>CCC | Hb York | HBB:c.440A>C | β | Causative | β-chain variant | NG_000007.3 | 72014 |
1315 | CD 146 CAC>CTC | Hb Cowtown | HBB:c.440A>T | β | Causative | β-chain variant | NG_000007.3 | 72014 |
1316 | CD 146 CAC>CGC | Hb Cochin-Port Royal | HBB:c.440A>G | β | Causative | β-chain variant | NG_000007.3 | 72014 |
1319 | CD 146/147 (+AC) | Hb Tak | HBB:c.440_441dupAC | β | Causative | β-chain variant | NG_000007.3 | 72014 |
1317 | CD 146 CAC>CAG | Hb Kodaira II | HBB:c.441C>G | β | Causative | β-chain variant | NG_000007.3 | 72015 |
1318 | CD 146 CAC>CAA | Hb Kodaira | HBB:c.441C>A | β | Causative | β-chain variant | NG_000007.3 | 72015 |
1320 | CD 147 (+TA) | Hb Monplaisir | HBB:c.442_443dupTA | β | Causative | β-chain variant | NG_000007.3 | 72016 |
3400 | CD 147 TAA>CAA [Stop>Gln] | Hb Zunyi | HBB:c.442T>C | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 72016 |
3697 | CD 147 TAA>ΑAA [Stop>Lys] | Hb Mokum | HBB:c.442T>A | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 72016 |
3444 | CD 147 TAA>TCA [Stop>Ser] | Hb Kanagawa | HBB:c.443A>C | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 72017 |
4104 | CD 147 TAA>ΑAC [Stop>Tyr] | N/A | HBB:c.444A>C | β | Causative | β-thalassaemia | NG_000007.3 | 72018 |
3863 | 3'UTR +1 G>A | N/A | HBB:c.*1G>A | β | Causative | β-thalassaemia | NG_000007.3 | 72019 |
2060 | 3'UTR +4 C>T (HBB:c.*4C>T, +1478 C>T) | N/A | NG_000007.3:g.72022C>T | β | Neutral | N/A | NG_000007.3 | 72022 |
267 | 3'UTR +6 C>G (Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G) | N/A | HBB:c.*6C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72024 |
3688 | 3'UTR +21 A>G | N/A | HBB:c.*21A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72039 |
2177 | 3'UTR +32 A>C (3'UTR +1506 (A>C), Terminal CD +32 A>C) | N/A | HBB:c.*32A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72050 |
268 | 3'UTR +47 C>G (Terminal CD +47 C>G) | N/A | HBB:c.*47C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72065 |
3180 | 3'UTR +62 A>G | N/A | HBB:c.*62A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72080 |
2061 | 3'UTR +67 G>T (HBB:c.*67G>T, +1541 G>T) | N/A | NG_000007.3:g.72085C>T | β | Neutral | N/A | NG_000007.3 | 72085 |
269 | 3'UTR -13 bp [CAP +1567 to +1579] | N/A | HBB:c.*93_*105delATCTGGATTCTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72111 |
3048 | 3'UTR, +C, -TGGATTCT | N/A | HBB:c.*96_*103delTGGATTCTinsC | β | Causative | β-thalassaemia | NG_000007.3 | 72113 |
3443 | Cap +1570 (T>C) | N/A | HBB:c.*96T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
4076 | Cap +1570 (T>G) | N/A | HBB:c.*96T>G | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
2063 | 3'UTR +104 G>A (+1578 G>A) | N/A | HBB:c.*104G>A | β | Neutral | N/A | NG_000007.3 | 72122 |
270 | Poly A (A>C) AATAAA>CATAAA | N/A | HBB:c.*108A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
271 | Poly A (A>G) AATAAA>GATAAA | N/A | HBB:c.*108A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
272 | Poly A (T>C) AATAAA>AACAAA | N/A | HBB:c.*110T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
273 | Poly A (T>A) AATAAA>AAAAAA | N/A | HBB:c.*110T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
277 | Poly A (-TA); (AATAAA>AAAA) | N/A | HBB:c.*110_*111delTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
278 | Poly A (-AATAA) (polyA (-TAAAA)) | N/A | HBB:c.*110_*114del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
4025 | Poly A (-T) AATAAA>AA-AAA | N/A | HBB:c.*110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
274 | Poly A (A>G) AATAAA>AATGAA | N/A | HBB:c.*111A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72129 |
275 | Poly A (A>G) AATAAA>AATAGA | N/A | HBB:c.*112A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
2198 | Poly A (A>T) AATAAA>AATATA | N/A | HBB:c.*112A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
276 | Poly A (A>G) AATAAA>AATAAG | N/A | HBB:c.*113A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72131 |
3046 | 3'UTR +115-+116 (-AA) (Poly A (-AA)) | N/A | HBB:c.*115_*116del | β | Causative | β-thalassaemia | NG_000007.3 | 72133 |
3933 | 3'UTR +116 (+A) (β nt + 1590 (+A)) | N/A | HBB:c.*116dup | β | Causative | β-thalassaemia | NG_000007.3 | 72134 |
2564 | 3'UTR +118 (A>G) (3'UTR +1592 (A>G)) | N/A | HBB:c.*118A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72136 |
3786 | 3'UTR +129 T>A | N/A | HBB:c.*129T>A | β | Causative | β-thalassaemia | NG_000007.3 | 72147 |
3605 | 3'UTR +132 C>T | N/A | HBB:c.*132C>T | β | Causative | β-thalassaemia | NG_000007.3 | 72150 |
4018 | 3'UTR +132 C>G | N/A | HBB:c.*132C>G | β | Causative | β-thalassaemia | NG_000007.3 | 72150 |
2064 | TTS +1 T>A (+1609 T>A, HBB:c.*135T>A) | N/A | NG_000007.3:g.72153T>A | β | Neutral | N/A | NG_000007.3 | 72153 |
3932 | TTS +8 T>C (β nt +1616 T>C) | N/A | HBB:c.*142T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72160 |
3931 | TTS +22 G>C (β nt +1630 G>C) | N/A | HBB:c.*156G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72174 |
3930 | TTS +43 (+A) (β nt +1651 (+A)) | N/A | HBB:c.*177dup | β | Causative | β-thalassaemia | NG_000007.3 | 72195 |
2496 | TTS +48 G>A (CAP +1656 G>A) | N/A | HBB:c.*182G>A | β | Causative | β-thalassaemia | NG_000007.3 | 72200 |
2463 | TTS +99 C>C | N/A | HBB:c.*233G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72251 |
3929 | TTS +113 T>C (β nt + 1721 T>C) | N/A | HBB:c.*247T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72265 |
3689 | TTS +127 T>C | N/A | HBB:c.*261T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72279 |
2816 | rs10837631 | N/A | NG_000007.3:g.72490A>T | β | Modifier | Hb F levels | NG_000007.3 | 72490 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-23 15:23:06