IthaID: 1562


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -110 A>C HGVS Name: HBG2:c.-163A>C
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GTTGGCCAGCCTTGCCTTGACCAAT [A/C] GCCTTGACAAGGCAAACTTGACCAA (Strand: -)

Also known as: Czech non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42725
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Czech
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Indrak K, Indrakova J, Kutlar F, Pospisilova D, Sulovska I, Baysal E, Huisman TH, Compound heterozygosity for a beta zero-thalassemia (frameshift codons 38/39; -C) and a nondeletional Swiss type of HPFH (A----C at NT -110, G gamma) in a Czechoslovakian family., Annals of hematology, 63(2), 111-5, 1991
Created on 2010-06-16 16:13:17, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.