IthaID: 1563

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -109 G>T HGVS Name: HBG2:c.-162G>T
Hb Name: N/A Protein Info: N/A
Also known as: Greek non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTTGGCCAGCCTTGCCTTGACCAATA [G/T] CCTTGACAAGGCAAACTTGACCAATA (Strand: -)

Comments: Identified in a 38-year-old female presenting with elevated Hb F levels (4.1%) and markedly increased Gγ-globin chain production (79.2%). This variant is located at the 3′ end of the HBG2 distal CCAAT box. It abolishes a transcription factor binding site, resulting in enhanced HBG2 transcription and ultimately leading to the HPFH phenotype.

External Links

No available links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42726
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Greek
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Chassanidis C, Kalamaras A, Phylactides M, Pourfarzad F, Likousi S, Maroulis V, Papadakis MN, Vamvakopoulos NK, Aleporou-Marinou V, Patrinos GP, Kollia P, The Hellenic type of nondeletional hereditary persistence of fetal hemoglobin results from a novel mutation (g.-109G>T) in the HBG2 gene promoter., Annals of hematology, 88(6), 549-55, 2009
Created on 2010-06-16 16:13:17, Last reviewed on 2026-04-17 07:35:21 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.