IthaID: 1571
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -175 T>C | HGVS Name: | HBG1:c.-228T>C |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | Black non-deletional HPFH |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTTCCCCACACTATCTCAATGCAAA [C/T] ATCTGTCTGAAACGGTCCCTGGCTA (Strand: -)
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 47584 |
| Size: | 1 bp |
| Located at: | Aγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Stoming TA, Stoming GS, Lanclos KD, Fei YJ, Altay C, Kutlar F, Huisman TH, An A gamma type of nondeletional hereditary persistence of fetal hemoglobin with a T----C mutation at position -175 to the cap site of the A gamma globin gene., Blood, 73(1), 329-33, 1989
- Coleman MB, Adams JG, Steinberg MH, Plonczynski MW, Harrell AH, Castro O, Winter WP, G gamma A gamma (beta+) hereditary persistence of fetal hemoglobin: the G gamma -158 C-->T mutation in cis to the -175 T-->C mutation of the A gamma-globin gene results in increased G gamma-globin synthesis., American journal of hematology, 42(2), 186-90, 1993
- Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016
Created on 2010-06-16 16:13:17,
Last reviewed on 2016-08-26 09:05:02 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.