
IthaID: 2050
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | CD 59 AAG>AAA [Lys>Lys] | HGVS Name: | HBB:c.180G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CTGATGCTGTTATGGGCAACCCTAA [G/A] GTGAAGGCTCATGGCAAGAAAGTGC (Strand: -)
Comments: Variation is reported in ClinVar as Likely benign with a 2-star review status (multiple submitters, no conflict).
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70904 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Muszlak M, Pissard S, Badens C, Chamouine A, Maillard O, Thuret I, Genetic Modifiers of Sickle Cell Disease: A Genotype-Phenotype Relationship Study in a Cohort of 82 Children on Mayotte Island., Hemoglobin, 39(3), 156-61, 2015
Created on 2013-06-27 12:45:57,
Last reviewed on 2023-12-21 10:48:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.