IthaID: 2067



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7557939 HGVS Name: NG_011968.1:g.64287C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TACATCCTTGAGCTACACAGGCTAA [A/G] CAAGAGTGAGAGAGGGTGATGCTGA (Strand: +)

Comments: Associated with elevated HbF in the Cooperative Study of Sickle Cell Disease (CSSCD) (n=1275), as well as in an independent study sample acquired from the CSSCD, the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study, and the Thomas Jefferson University (n=254). Associated with HbF levels in individuals from Brazil with sickle cell disease (n=350). Associated with fewer pain events at baseline and after HU treatment in young patients with SCA (BABY HUG cohort), and with higher Hb levels at study entry [PMID: 23606168]. Associated with HbF levels, as well as risk of painful episodes in a pediatric cohort with sickle cell anemia from southeastern Brazil (n=250).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Pain [HP:0012531]
Anaemia [HP:0001903]

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 64287
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008 PubMed
  2. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013 PubMed
  3. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  4. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
  5. Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020 PubMed
Created on 2013-06-28 11:49:33, Last reviewed on 2022-03-31 10:41:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.